FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641493_at:

>probe:Drosophila_2:1641493_at:509:225; Interrogation_Position=283; Antisense; AAGGACGATGATGACCAGGCAGCGG
>probe:Drosophila_2:1641493_at:323:249; Interrogation_Position=379; Antisense; CAACCCATCTTGTTCGAAATTACAG
>probe:Drosophila_2:1641493_at:98:723; Interrogation_Position=388; Antisense; TTGTTCGAAATTACAGTGGCCGCCA
>probe:Drosophila_2:1641493_at:711:635; Interrogation_Position=392; Antisense; TCGAAATTACAGTGGCCGCCAACTA
>probe:Drosophila_2:1641493_at:391:633; Interrogation_Position=494; Antisense; TCCGCCAGACGTTCAACATCGAAGA
>probe:Drosophila_2:1641493_at:500:253; Interrogation_Position=499; Antisense; CAGACGTTCAACATCGAAGACGATT
>probe:Drosophila_2:1641493_at:687:151; Interrogation_Position=509; Antisense; ACATCGAAGACGATTTACCGATCGA
>probe:Drosophila_2:1641493_at:645:459; Interrogation_Position=520; Antisense; GATTTACCGATCGATACGGCCGAGT
>probe:Drosophila_2:1641493_at:293:705; Interrogation_Position=523; Antisense; TTACCGATCGATACGGCCGAGTTGG
>probe:Drosophila_2:1641493_at:559:455; Interrogation_Position=532; Antisense; GATACGGCCGAGTTGGGCGAAGACC
>probe:Drosophila_2:1641493_at:317:325; Interrogation_Position=548; Antisense; GCGAAGACCTGTGAGGCACAGAGAA
>probe:Drosophila_2:1641493_at:243:691; Interrogation_Position=584; Antisense; TTCACCGGAACCTTACTTTGTTGAG
>probe:Drosophila_2:1641493_at:160:719; Interrogation_Position=616; Antisense; TTGTTTCGCCTAGATAAATATACTA
>probe:Drosophila_2:1641493_at:249:357; Interrogation_Position=74; Antisense; GCAAACCGAAAATGGATGCTCCCAC

Paste this into a BLAST search page for me
AAGGACGATGATGACCAGGCAGCGGCAACCCATCTTGTTCGAAATTACAGTTGTTCGAAATTACAGTGGCCGCCATCGAAATTACAGTGGCCGCCAACTATCCGCCAGACGTTCAACATCGAAGACAGACGTTCAACATCGAAGACGATTACATCGAAGACGATTTACCGATCGAGATTTACCGATCGATACGGCCGAGTTTACCGATCGATACGGCCGAGTTGGGATACGGCCGAGTTGGGCGAAGACCGCGAAGACCTGTGAGGCACAGAGAATTCACCGGAACCTTACTTTGTTGAGTTGTTTCGCCTAGATAAATATACTAGCAAACCGAAAATGGATGCTCCCAC

Full Affymetrix probeset data:

Annotations for 1641493_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720