FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641494_at:

>probe:Drosophila_2:1641494_at:677:715; Interrogation_Position=362; Antisense; TTCGTCCGCGAGGATGGGCAGTTCA
>probe:Drosophila_2:1641494_at:433:93; Interrogation_Position=381; Antisense; AGTTCATGATCAGCGGAGTGCCATC
>probe:Drosophila_2:1641494_at:38:47; Interrogation_Position=403; Antisense; ATCCGGCAGCTATATCCTGGATGTC
>probe:Drosophila_2:1641494_at:507:547; Interrogation_Position=436; Antisense; GGATGTTTTCTATGAGCCGGTGCGC
>probe:Drosophila_2:1641494_at:521:505; Interrogation_Position=455; Antisense; GTGCGCGTCGAGATCAATCCCAAGG
>probe:Drosophila_2:1641494_at:614:509; Interrogation_Position=551; Antisense; GTGAAGCCACTGATGCCCTTTAAAT
>probe:Drosophila_2:1641494_at:667:577; Interrogation_Position=564; Antisense; TGCCCTTTAAATACTTCCAGACCAG
>probe:Drosophila_2:1641494_at:343:563; Interrogation_Position=597; Antisense; GGAAGATCACCGACTTCTTGTTCAG
>probe:Drosophila_2:1641494_at:424:63; Interrogation_Position=626; Antisense; ATGGTCCTAATGATGGTCTTGCCTC
>probe:Drosophila_2:1641494_at:372:591; Interrogation_Position=663; Antisense; TGGTGCTGCCCAAGATGATCAACGA
>probe:Drosophila_2:1641494_at:118:199; Interrogation_Position=737; Antisense; AACGATATGCCCGAGATCAGCGAAA
>probe:Drosophila_2:1641494_at:18:167; Interrogation_Position=759; Antisense; AAATGCTGACTTCACTGCTAACGGG
>probe:Drosophila_2:1641494_at:292:463; Interrogation_Position=859; Antisense; GTTGGCCACCAGATAGCTTTTAGTA
>probe:Drosophila_2:1641494_at:411:481; Interrogation_Position=881; Antisense; GTATTAAGCTTAATCGGAGCGCCGA

Paste this into a BLAST search page for me
TTCGTCCGCGAGGATGGGCAGTTCAAGTTCATGATCAGCGGAGTGCCATCATCCGGCAGCTATATCCTGGATGTCGGATGTTTTCTATGAGCCGGTGCGCGTGCGCGTCGAGATCAATCCCAAGGGTGAAGCCACTGATGCCCTTTAAATTGCCCTTTAAATACTTCCAGACCAGGGAAGATCACCGACTTCTTGTTCAGATGGTCCTAATGATGGTCTTGCCTCTGGTGCTGCCCAAGATGATCAACGAAACGATATGCCCGAGATCAGCGAAAAAATGCTGACTTCACTGCTAACGGGGTTGGCCACCAGATAGCTTTTAGTAGTATTAAGCTTAATCGGAGCGCCGA

Full Affymetrix probeset data:

Annotations for 1641494_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720