Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641496_a_at:

>probe:Drosophila_2:1641496_a_at:635:337; Interrogation_Position=1076; Antisense; GCTCAGTCAACTTTGCGTGGGTGGT
>probe:Drosophila_2:1641496_a_at:649:167; Interrogation_Position=1183; Antisense; AAATGGTCGAGTTCGGGATCGTCAG
>probe:Drosophila_2:1641496_a_at:441:449; Interrogation_Position=1199; Antisense; GATCGTCAGCCAGGGTGTGGTCACC
>probe:Drosophila_2:1641496_a_at:295:283; Interrogation_Position=1239; Antisense; CTGCCCGGTCTGTACACAAATGTGG
>probe:Drosophila_2:1641496_a_at:623:83; Interrogation_Position=1276; Antisense; AGTGGATCACGGACACCATGGCCAG
>probe:Drosophila_2:1641496_a_at:388:239; Interrogation_Position=1318; Antisense; AATCATCATTCGTTGGCAGTTCTTA
>probe:Drosophila_2:1641496_a_at:586:349; Interrogation_Position=1333; Antisense; GCAGTTCTTAGAGCGTTCCTTAGTA
>probe:Drosophila_2:1641496_a_at:99:13; Interrogation_Position=810; Antisense; ATTCATGAGAAGTACGACGCCCGCC
>probe:Drosophila_2:1641496_a_at:248:269; Interrogation_Position=839; Antisense; CATGCATGACATAGCTCTCCTGAAG
>probe:Drosophila_2:1641496_a_at:56:615; Interrogation_Position=859; Antisense; TGAAGCTCAACAGGAGCGTCCCCTT
>probe:Drosophila_2:1641496_a_at:321:721; Interrogation_Position=882; Antisense; TTCCAGAAGCACATCAAGCCCATTT
>probe:Drosophila_2:1641496_a_at:51:97; Interrogation_Position=946; Antisense; AGATAAGCACCTACTTCGTGACCGG
>probe:Drosophila_2:1641496_a_at:710:567; Interrogation_Position=975; Antisense; GGCACCACGGAGAACGGCTCGTCGT
>probe:Drosophila_2:1641496_a_at:23:501; Interrogation_Position=998; Antisense; GTCGGATGTGTTGCTCCAGGCGAAC

Paste this into a BLAST search page for me
GCTCAGTCAACTTTGCGTGGGTGGTAAATGGTCGAGTTCGGGATCGTCAGGATCGTCAGCCAGGGTGTGGTCACCCTGCCCGGTCTGTACACAAATGTGGAGTGGATCACGGACACCATGGCCAGAATCATCATTCGTTGGCAGTTCTTAGCAGTTCTTAGAGCGTTCCTTAGTAATTCATGAGAAGTACGACGCCCGCCCATGCATGACATAGCTCTCCTGAAGTGAAGCTCAACAGGAGCGTCCCCTTTTCCAGAAGCACATCAAGCCCATTTAGATAAGCACCTACTTCGTGACCGGGGCACCACGGAGAACGGCTCGTCGTGTCGGATGTGTTGCTCCAGGCGAAC

Full Affymetrix probeset data:

Annotations for 1641496_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime