FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641498_at:

>probe:Drosophila_2:1641498_at:643:697; Interrogation_Position=1004; Antisense; TTTACAGTCAGCTCGATGCACGGCG
>probe:Drosophila_2:1641498_at:559:645; Interrogation_Position=1056; Antisense; TCATGAAGGAGTTCCGAGCCGGCCA
>probe:Drosophila_2:1641498_at:272:433; Interrogation_Position=1086; Antisense; GAGTGCTCATCACCACCGATGTGTG
>probe:Drosophila_2:1641498_at:520:669; Interrogation_Position=1154; Antisense; TACGATTTGCCCAACAACCGTGAGC
>probe:Drosophila_2:1641498_at:102:203; Interrogation_Position=1169; Antisense; AACCGTGAGCTGTACATCCATCGCA
>probe:Drosophila_2:1641498_at:692:269; Interrogation_Position=1192; Antisense; CATCGGTCGTTCTGGTCGTTTCGGA
>probe:Drosophila_2:1641498_at:572:165; Interrogation_Position=1244; Antisense; AAATCGGACGATATCCGCATCCTGC
>probe:Drosophila_2:1641498_at:27:89; Interrogation_Position=1281; Antisense; AGTACTACTCCACACAAATCGACGA
>probe:Drosophila_2:1641498_at:183:383; Interrogation_Position=1315; Antisense; GAACGTGGCTGACTTGATCTAAACT
>probe:Drosophila_2:1641498_at:320:705; Interrogation_Position=1358; Antisense; TTATGTAACGCACTTTTCCTAGCCG
>probe:Drosophila_2:1641498_at:314:247; Interrogation_Position=891; Antisense; AATTCGATACCCTGTGCGATCTGTA
>probe:Drosophila_2:1641498_at:31:453; Interrogation_Position=908; Antisense; GATCTGTACGATACTCTGACCATTA
>probe:Drosophila_2:1641498_at:68:579; Interrogation_Position=937; Antisense; GGCCGTCATCTTCTGCAACACGAAA
>probe:Drosophila_2:1641498_at:543:447; Interrogation_Position=988; Antisense; GATGCGCGAGGCTAACTTTACAGTC

Paste this into a BLAST search page for me
TTTACAGTCAGCTCGATGCACGGCGTCATGAAGGAGTTCCGAGCCGGCCAGAGTGCTCATCACCACCGATGTGTGTACGATTTGCCCAACAACCGTGAGCAACCGTGAGCTGTACATCCATCGCACATCGGTCGTTCTGGTCGTTTCGGAAAATCGGACGATATCCGCATCCTGCAGTACTACTCCACACAAATCGACGAGAACGTGGCTGACTTGATCTAAACTTTATGTAACGCACTTTTCCTAGCCGAATTCGATACCCTGTGCGATCTGTAGATCTGTACGATACTCTGACCATTAGGCCGTCATCTTCTGCAACACGAAAGATGCGCGAGGCTAACTTTACAGTC

Full Affymetrix probeset data:

Annotations for 1641498_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720