Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641499_at:

>probe:Drosophila_2:1641499_at:501:621; Interrogation_Position=1187; Antisense; TGCTCCAGCCAAACGATCAGATCAA
>probe:Drosophila_2:1641499_at:459:129; Interrogation_Position=1240; Antisense; ACCTTTGGCGACTTGGACGACGACG
>probe:Drosophila_2:1641499_at:55:513; Interrogation_Position=1276; Antisense; GTGATCATAGAAGATTCCGCCGCCC
>probe:Drosophila_2:1641499_at:647:299; Interrogation_Position=1293; Antisense; CGCCGCCCATGATATTGTCGAAGGT
>probe:Drosophila_2:1641499_at:465:371; Interrogation_Position=1339; Antisense; GAAGGACAGCTCGATGCCCAGGGAC
>probe:Drosophila_2:1641499_at:447:383; Interrogation_Position=1396; Antisense; GAACTGGTCAATCAAGGCGCCGAAG
>probe:Drosophila_2:1641499_at:251:715; Interrogation_Position=1455; Antisense; TTCTGCGCGCCAGGTGAACGACGTA
>probe:Drosophila_2:1641499_at:344:483; Interrogation_Position=1486; Antisense; GTAGTCCAAAAGCTCACCAAGTCGA
>probe:Drosophila_2:1641499_at:144:251; Interrogation_Position=1503; Antisense; CAAGTCGATAGGTCCGCTGGGTAAA
>probe:Drosophila_2:1641499_at:79:669; Interrogation_Position=1529; Antisense; TACTGGACTGCATACCCGAGGATTT
>probe:Drosophila_2:1641499_at:727:587; Interrogation_Position=1568; Antisense; TGGAGCTTACGATGTGGCGCGACAC
>probe:Drosophila_2:1641499_at:179:171; Interrogation_Position=1619; Antisense; AAAGGGAGCAGACTCTCACGGCATC
>probe:Drosophila_2:1641499_at:208:255; Interrogation_Position=1675; Antisense; CAAATCCAAGCCAGCATTGCGGAGT
>probe:Drosophila_2:1641499_at:599:137; Interrogation_Position=1715; Antisense; ACGAGAGTCGCCACAAGATCTTGCA

Paste this into a BLAST search page for me
TGCTCCAGCCAAACGATCAGATCAAACCTTTGGCGACTTGGACGACGACGGTGATCATAGAAGATTCCGCCGCCCCGCCGCCCATGATATTGTCGAAGGTGAAGGACAGCTCGATGCCCAGGGACGAACTGGTCAATCAAGGCGCCGAAGTTCTGCGCGCCAGGTGAACGACGTAGTAGTCCAAAAGCTCACCAAGTCGACAAGTCGATAGGTCCGCTGGGTAAATACTGGACTGCATACCCGAGGATTTTGGAGCTTACGATGTGGCGCGACACAAAGGGAGCAGACTCTCACGGCATCCAAATCCAAGCCAGCATTGCGGAGTACGAGAGTCGCCACAAGATCTTGCA

Full Affymetrix probeset data:

Annotations for 1641499_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime