Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641502_a_at:

>probe:Drosophila_2:1641502_a_at:281:103; Interrogation_Position=1027; Antisense; AGAGCTGGCACTTGAACTTCCTATA
>probe:Drosophila_2:1641502_a_at:138:271; Interrogation_Position=517; Antisense; CATCTCCGTGGGTCTGAAGGTGAAC
>probe:Drosophila_2:1641502_a_at:469:141; Interrogation_Position=548; Antisense; ACGGAGCTGGGCTTGGTCTACAATC
>probe:Drosophila_2:1641502_a_at:27:161; Interrogation_Position=567; Antisense; ACAATCCCATTCTAGAGCAACGCTT
>probe:Drosophila_2:1641502_a_at:161:555; Interrogation_Position=611; Antisense; GGAGCCTTCTACAACGGGCGCAGGA
>probe:Drosophila_2:1641502_a_at:376:349; Interrogation_Position=630; Antisense; GCAGGATCCACGTTAGCGGCCAGAA
>probe:Drosophila_2:1641502_a_at:320:379; Interrogation_Position=656; Antisense; GAACTGGGCAAAGCGCTGGTTACCA
>probe:Drosophila_2:1641502_a_at:364:707; Interrogation_Position=675; Antisense; TTACCAGTGAATTCGGTACCACCCG
>probe:Drosophila_2:1641502_a_at:492:471; Interrogation_Position=777; Antisense; GTTCGGCAGCTCTCAATATGTCGAT
>probe:Drosophila_2:1641502_a_at:152:321; Interrogation_Position=815; Antisense; GCCGCCGACGCTAACTATGAATTTG
>probe:Drosophila_2:1641502_a_at:219:243; Interrogation_Position=834; Antisense; AATTTGGAATTCACGCCTGGGATGT
>probe:Drosophila_2:1641502_a_at:156:333; Interrogation_Position=911; Antisense; GCTGGCGGCGAATTCGACATCATGT
>probe:Drosophila_2:1641502_a_at:500:151; Interrogation_Position=927; Antisense; ACATCATGTCTCGAAGGGTCCTGGC
>probe:Drosophila_2:1641502_a_at:532:427; Interrogation_Position=977; Antisense; GAGATCTCCAAGGTGCTAACGCAGT

Paste this into a BLAST search page for me
AGAGCTGGCACTTGAACTTCCTATACATCTCCGTGGGTCTGAAGGTGAACACGGAGCTGGGCTTGGTCTACAATCACAATCCCATTCTAGAGCAACGCTTGGAGCCTTCTACAACGGGCGCAGGAGCAGGATCCACGTTAGCGGCCAGAAGAACTGGGCAAAGCGCTGGTTACCATTACCAGTGAATTCGGTACCACCCGGTTCGGCAGCTCTCAATATGTCGATGCCGCCGACGCTAACTATGAATTTGAATTTGGAATTCACGCCTGGGATGTGCTGGCGGCGAATTCGACATCATGTACATCATGTCTCGAAGGGTCCTGGCGAGATCTCCAAGGTGCTAACGCAGT

Full Affymetrix probeset data:

Annotations for 1641502_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime