FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641506_at:

>probe:Drosophila_2:1641506_at:404:25; Interrogation_Position=120; Antisense; ATATGGAATCCGATTGCCTGCGGTG
>probe:Drosophila_2:1641506_at:625:575; Interrogation_Position=156; Antisense; GGCGCGGCCATTTTCATCAACTGGG
>probe:Drosophila_2:1641506_at:579:601; Interrogation_Position=196; Antisense; TGTTTTCCGGCATCCAGAAGCACAT
>probe:Drosophila_2:1641506_at:146:133; Interrogation_Position=21; Antisense; ACCGCTATTGTTTTTCATCCTATCA
>probe:Drosophila_2:1641506_at:489:209; Interrogation_Position=213; Antisense; AAGCACATCGCCTTCGGAGCTATCG
>probe:Drosophila_2:1641506_at:76:577; Interrogation_Position=243; Antisense; GGCGCAGGAGCTTATTTCGATCAGA
>probe:Drosophila_2:1641506_at:160:375; Interrogation_Position=266; Antisense; GAAGAGGAACGAGTACCTGGCCAAA
>probe:Drosophila_2:1641506_at:674:667; Interrogation_Position=312; Antisense; TACATCGAACTGCATCCCGACGATT
>probe:Drosophila_2:1641506_at:152:409; Interrogation_Position=330; Antisense; GACGATTTCCCGGTGAAGGAACGCA
>probe:Drosophila_2:1641506_at:643:561; Interrogation_Position=347; Antisense; GGAACGCAAGACCTATGGCCAAGTG
>probe:Drosophila_2:1641506_at:115:507; Interrogation_Position=384; Antisense; GTGCCAGTGCGCTAAGTGGATCTAA
>probe:Drosophila_2:1641506_at:327:57; Interrogation_Position=48; Antisense; ATGAGTGCCGTGAACGATCCGCTGG
>probe:Drosophila_2:1641506_at:388:449; Interrogation_Position=63; Antisense; GATCCGCTGGAACTTTTGACGAACA
>probe:Drosophila_2:1641506_at:204:699; Interrogation_Position=76; Antisense; TTTTGACGAACAAGGGCACCCACGA

Paste this into a BLAST search page for me
ATATGGAATCCGATTGCCTGCGGTGGGCGCGGCCATTTTCATCAACTGGGTGTTTTCCGGCATCCAGAAGCACATACCGCTATTGTTTTTCATCCTATCAAAGCACATCGCCTTCGGAGCTATCGGGCGCAGGAGCTTATTTCGATCAGAGAAGAGGAACGAGTACCTGGCCAAATACATCGAACTGCATCCCGACGATTGACGATTTCCCGGTGAAGGAACGCAGGAACGCAAGACCTATGGCCAAGTGGTGCCAGTGCGCTAAGTGGATCTAAATGAGTGCCGTGAACGATCCGCTGGGATCCGCTGGAACTTTTGACGAACATTTTGACGAACAAGGGCACCCACGA

Full Affymetrix probeset data:

Annotations for 1641506_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720