Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641508_s_at:

>probe:Drosophila_2:1641508_s_at:331:125; Interrogation_Position=490; Antisense; AGCCGAGATTTCCTACCGGATTCTT
>probe:Drosophila_2:1641508_s_at:671:131; Interrogation_Position=504; Antisense; ACCGGATTCTTTGAGGCAGGGACTT
>probe:Drosophila_2:1641508_s_at:322:149; Interrogation_Position=525; Antisense; ACTTGACGACCTGTGGGACTTGCAA
>probe:Drosophila_2:1641508_s_at:113:189; Interrogation_Position=571; Antisense; AACACCTACGAGGAGTGGCTTCACT
>probe:Drosophila_2:1641508_s_at:110:295; Interrogation_Position=615; Antisense; CGAGGACTACCTGCACTTGGAGAAG
>probe:Drosophila_2:1641508_s_at:29:469; Interrogation_Position=653; Antisense; GTTGTTGTCTCAATCGGGACTGCAC
>probe:Drosophila_2:1641508_s_at:258:527; Interrogation_Position=668; Antisense; GGGACTGCACCAAGCATCTGAATCT
>probe:Drosophila_2:1641508_s_at:124:367; Interrogation_Position=687; Antisense; GAATCTTTTCATGACAGGCTGCGAA
>probe:Drosophila_2:1641508_s_at:309:259; Interrogation_Position=754; Antisense; CACTCGCTAAGTTGGTTCCTTGTTA
>probe:Drosophila_2:1641508_s_at:168:541; Interrogation_Position=767; Antisense; GGTTCCTTGTTATCTTTGAGTTCGC
>probe:Drosophila_2:1641508_s_at:254:539; Interrogation_Position=816; Antisense; GGTAGACAGCATTCGCAATCATCGC
>probe:Drosophila_2:1641508_s_at:95:697; Interrogation_Position=872; Antisense; TTTAGGGATTTGCACGAACCGTATT
>probe:Drosophila_2:1641508_s_at:706:603; Interrogation_Position=911; Antisense; TGAGTAATTTCCTAGCCATACGGCC
>probe:Drosophila_2:1641508_s_at:573:141; Interrogation_Position=930; Antisense; ACGGCCCTGGCGAATTGTGATTGTA

Paste this into a BLAST search page for me
AGCCGAGATTTCCTACCGGATTCTTACCGGATTCTTTGAGGCAGGGACTTACTTGACGACCTGTGGGACTTGCAAAACACCTACGAGGAGTGGCTTCACTCGAGGACTACCTGCACTTGGAGAAGGTTGTTGTCTCAATCGGGACTGCACGGGACTGCACCAAGCATCTGAATCTGAATCTTTTCATGACAGGCTGCGAACACTCGCTAAGTTGGTTCCTTGTTAGGTTCCTTGTTATCTTTGAGTTCGCGGTAGACAGCATTCGCAATCATCGCTTTAGGGATTTGCACGAACCGTATTTGAGTAATTTCCTAGCCATACGGCCACGGCCCTGGCGAATTGTGATTGTA

Full Affymetrix probeset data:

Annotations for 1641508_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime