Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641509_at:

>probe:Drosophila_2:1641509_at:390:223; Interrogation_Position=2824; Antisense; AAGGTGGTGCGCTATGATGCCGCTC
>probe:Drosophila_2:1641509_at:405:453; Interrogation_Position=2952; Antisense; GATCAACGGAGCACAGTTCCCGATT
>probe:Drosophila_2:1641509_at:305:293; Interrogation_Position=2972; Antisense; CGATTCCCGATAGCGAGGAGCTGCT
>probe:Drosophila_2:1641509_at:154:419; Interrogation_Position=2989; Antisense; GAGCTGCTAGGCAAGCGCATTGTCA
>probe:Drosophila_2:1641509_at:639:5; Interrogation_Position=3007; Antisense; ATTGTCAGCGTGGTAGTCCTGGCTC
>probe:Drosophila_2:1641509_at:13:521; Interrogation_Position=3034; Antisense; GTGGAGGCCCAAAATCCTGGACAGG
>probe:Drosophila_2:1641509_at:233:513; Interrogation_Position=3110; Antisense; GTGAGCTCATCAAGACGCTGGTGAA
>probe:Drosophila_2:1641509_at:564:65; Interrogation_Position=3176; Antisense; AGGCGCGTACGGATTTGGAACTGCA
>probe:Drosophila_2:1641509_at:698:265; Interrogation_Position=3230; Antisense; CAGATCCATCCGCTGAGCAGGAGAT
>probe:Drosophila_2:1641509_at:710:507; Interrogation_Position=3271; Antisense; GGAACGGGTAGCATAAACCGCCTCA
>probe:Drosophila_2:1641509_at:456:527; Interrogation_Position=3299; Antisense; GGGAGCTATCCAGCACGTTTGTAAA
>probe:Drosophila_2:1641509_at:312:41; Interrogation_Position=3353; Antisense; ATCTGGAGCACGCAGCCACATTGGA
>probe:Drosophila_2:1641509_at:673:409; Interrogation_Position=3376; Antisense; GACCATAGTTCGCTGGAGTCCATGA
>probe:Drosophila_2:1641509_at:150:589; Interrogation_Position=3389; Antisense; TGGAGTCCATGATGCATCTGCGCCG

Paste this into a BLAST search page for me
AAGGTGGTGCGCTATGATGCCGCTCGATCAACGGAGCACAGTTCCCGATTCGATTCCCGATAGCGAGGAGCTGCTGAGCTGCTAGGCAAGCGCATTGTCAATTGTCAGCGTGGTAGTCCTGGCTCGTGGAGGCCCAAAATCCTGGACAGGGTGAGCTCATCAAGACGCTGGTGAAAGGCGCGTACGGATTTGGAACTGCACAGATCCATCCGCTGAGCAGGAGATGGAACGGGTAGCATAAACCGCCTCAGGGAGCTATCCAGCACGTTTGTAAAATCTGGAGCACGCAGCCACATTGGAGACCATAGTTCGCTGGAGTCCATGATGGAGTCCATGATGCATCTGCGCCG

Full Affymetrix probeset data:

Annotations for 1641509_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime