FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641510_at:

>probe:Drosophila_2:1641510_at:226:543; Interrogation_Position=7146; Antisense; GGATAGCCTCAGTAACTCCGTAGAG
>probe:Drosophila_2:1641510_at:301:69; Interrogation_Position=7183; Antisense; ATGGCCAAGTCGAAGCCCTACGATC
>probe:Drosophila_2:1641510_at:580:669; Interrogation_Position=7201; Antisense; TACGATCCGACGCTACAGCAAGGCG
>probe:Drosophila_2:1641510_at:280:615; Interrogation_Position=7229; Antisense; TGCACAACAACGTGGCCGACGAGAC
>probe:Drosophila_2:1641510_at:445:203; Interrogation_Position=7262; Antisense; AAGCCAGCCAGGTAATCAAGCGGGT
>probe:Drosophila_2:1641510_at:417:207; Interrogation_Position=7294; Antisense; AAGCTAACAGGCACCGACTTCCAGA
>probe:Drosophila_2:1641510_at:490:29; Interrogation_Position=7376; Antisense; ATAACGAGAACCTCTGCCAGTGCTA
>probe:Drosophila_2:1641510_at:1:315; Interrogation_Position=7391; Antisense; GCCAGTGCTACATTGGCTGGTGTCC
>probe:Drosophila_2:1641510_at:173:331; Interrogation_Position=7406; Antisense; GCTGGTGTCCGTTTTGGTAGGTCAA
>probe:Drosophila_2:1641510_at:627:537; Interrogation_Position=7421; Antisense; GGTAGGTCAACCGATCCGGCATAGA
>probe:Drosophila_2:1641510_at:191:677; Interrogation_Position=7442; Antisense; TAGATCCCGTGCGACAACCGGCAAT
>probe:Drosophila_2:1641510_at:27:203; Interrogation_Position=7457; Antisense; AACCGGCAATTGACTGAGCGAGATT
>probe:Drosophila_2:1641510_at:158:249; Interrogation_Position=7510; Antisense; AATTGGGTGCATGCATCTCTGGAGA
>probe:Drosophila_2:1641510_at:56:543; Interrogation_Position=7535; Antisense; GGATTCCGAGGTGACTGCAAACTAG

Paste this into a BLAST search page for me
GGATAGCCTCAGTAACTCCGTAGAGATGGCCAAGTCGAAGCCCTACGATCTACGATCCGACGCTACAGCAAGGCGTGCACAACAACGTGGCCGACGAGACAAGCCAGCCAGGTAATCAAGCGGGTAAGCTAACAGGCACCGACTTCCAGAATAACGAGAACCTCTGCCAGTGCTAGCCAGTGCTACATTGGCTGGTGTCCGCTGGTGTCCGTTTTGGTAGGTCAAGGTAGGTCAACCGATCCGGCATAGATAGATCCCGTGCGACAACCGGCAATAACCGGCAATTGACTGAGCGAGATTAATTGGGTGCATGCATCTCTGGAGAGGATTCCGAGGTGACTGCAAACTAG

Full Affymetrix probeset data:

Annotations for 1641510_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720