FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641511_at:

>probe:Drosophila_2:1641511_at:515:593; Interrogation_Position=112; Antisense; TGGGATTCGCCGGAAAGCACCTGAT
>probe:Drosophila_2:1641511_at:95:613; Interrogation_Position=16; Antisense; TGACAGCAGGCTATGCAGTTCCACT
>probe:Drosophila_2:1641511_at:344:381; Interrogation_Position=182; Antisense; GAACCTGCCCAAATACGATGCGGAG
>probe:Drosophila_2:1641511_at:322:581; Interrogation_Position=211; Antisense; TGGCCGCCTCCAAATACTACAAGGG
>probe:Drosophila_2:1641511_at:131:575; Interrogation_Position=234; Antisense; GGCGGCTTCGATCCCAAGATGAACA
>probe:Drosophila_2:1641511_at:473:69; Interrogation_Position=265; Antisense; AGGCGTCCCTAATCCTAGGTGTCAG
>probe:Drosophila_2:1641511_at:112:125; Interrogation_Position=288; Antisense; AGCCCCAGTGCGTCCAAGATAAAGA
>probe:Drosophila_2:1641511_at:241:351; Interrogation_Position=30; Antisense; GCAGTTCCACTGACTTACAGCTGTT
>probe:Drosophila_2:1641511_at:730:45; Interrogation_Position=336; Antisense; ATGCTGTTGAACCATCCGGATCGAG
>probe:Drosophila_2:1641511_at:204:435; Interrogation_Position=361; Antisense; GAGGATCTCCCTATTTGGCGGCCAA
>probe:Drosophila_2:1641511_at:342:159; Interrogation_Position=412; Antisense; ACAAAGCGAAGTAGTCATCCTCTCC
>probe:Drosophila_2:1641511_at:576:631; Interrogation_Position=434; Antisense; TCCCCGCCGTTCAGTGCAAATAAAG
>probe:Drosophila_2:1641511_at:447:167; Interrogation_Position=67; Antisense; AAATGGCGAGCTCCGTAATTCTGGC
>probe:Drosophila_2:1641511_at:90:655; Interrogation_Position=82; Antisense; TAATTCTGGCGGGTCTTAGCGTGGC

Paste this into a BLAST search page for me
TGGGATTCGCCGGAAAGCACCTGATTGACAGCAGGCTATGCAGTTCCACTGAACCTGCCCAAATACGATGCGGAGTGGCCGCCTCCAAATACTACAAGGGGGCGGCTTCGATCCCAAGATGAACAAGGCGTCCCTAATCCTAGGTGTCAGAGCCCCAGTGCGTCCAAGATAAAGAGCAGTTCCACTGACTTACAGCTGTTATGCTGTTGAACCATCCGGATCGAGGAGGATCTCCCTATTTGGCGGCCAAACAAAGCGAAGTAGTCATCCTCTCCTCCCCGCCGTTCAGTGCAAATAAAGAAATGGCGAGCTCCGTAATTCTGGCTAATTCTGGCGGGTCTTAGCGTGGC

Full Affymetrix probeset data:

Annotations for 1641511_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720