Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641512_at:

>probe:Drosophila_2:1641512_at:663:517; Interrogation_Position=1591; Antisense; GTGGTCAGTTTGGAGCAGCCCGAAC
>probe:Drosophila_2:1641512_at:391:609; Interrogation_Position=1616; Antisense; TGAGCACAACTGTTTCAGCGCCATC
>probe:Drosophila_2:1641512_at:199:237; Interrogation_Position=1655; Antisense; CAACCACTGAGACTGCAAGCACTGA
>probe:Drosophila_2:1641512_at:102:209; Interrogation_Position=1671; Antisense; AAGCACTGAGAGATCCACACACGTC
>probe:Drosophila_2:1641512_at:127:139; Interrogation_Position=1705; Antisense; ACGATCGCCAGTTTTGTGTCCACCT
>probe:Drosophila_2:1641512_at:185:679; Interrogation_Position=1740; Antisense; TAGTCCATTGCGCTCCATTAGTAGG
>probe:Drosophila_2:1641512_at:669:13; Interrogation_Position=1756; Antisense; ATTAGTAGGTATCGCACCACGCCAA
>probe:Drosophila_2:1641512_at:710:455; Interrogation_Position=1782; Antisense; GATAACAGCTGGACGATCCACCACA
>probe:Drosophila_2:1641512_at:621:111; Interrogation_Position=1822; Antisense; AGCACGGAACCACCGCTGAATAAGT
>probe:Drosophila_2:1641512_at:568:379; Interrogation_Position=1900; Antisense; GAAGCCTTCGTTAGCACCACTTCGT
>probe:Drosophila_2:1641512_at:471:435; Interrogation_Position=2035; Antisense; GAGGTGCTCACCCAGAAATCGGTTA
>probe:Drosophila_2:1641512_at:729:637; Interrogation_Position=2053; Antisense; TCGGTTAGTCGATCTGTGAGCATCA
>probe:Drosophila_2:1641512_at:312:427; Interrogation_Position=2098; Antisense; GAGATACCCATCATTGTGGACGACG
>probe:Drosophila_2:1641512_at:17:435; Interrogation_Position=2131; Antisense; GAGGTGAAGCCAGTGCTGACTAATT

Paste this into a BLAST search page for me
GTGGTCAGTTTGGAGCAGCCCGAACTGAGCACAACTGTTTCAGCGCCATCCAACCACTGAGACTGCAAGCACTGAAAGCACTGAGAGATCCACACACGTCACGATCGCCAGTTTTGTGTCCACCTTAGTCCATTGCGCTCCATTAGTAGGATTAGTAGGTATCGCACCACGCCAAGATAACAGCTGGACGATCCACCACAAGCACGGAACCACCGCTGAATAAGTGAAGCCTTCGTTAGCACCACTTCGTGAGGTGCTCACCCAGAAATCGGTTATCGGTTAGTCGATCTGTGAGCATCAGAGATACCCATCATTGTGGACGACGGAGGTGAAGCCAGTGCTGACTAATT

Full Affymetrix probeset data:

Annotations for 1641512_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime