Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641513_at:

>probe:Drosophila_2:1641513_at:218:215; Interrogation_Position=1768; Antisense; AAGATCTTCGCCGAGAACGCCGAGT
>probe:Drosophila_2:1641513_at:606:485; Interrogation_Position=1812; Antisense; GTAGACCGTGATCATGTTCAACGCG
>probe:Drosophila_2:1641513_at:658:473; Interrogation_Position=1827; Antisense; GTTCAACGCGAGCTTTCCAGACGAG
>probe:Drosophila_2:1641513_at:281:137; Interrogation_Position=1847; Antisense; ACGAGCGATTCGTGAGCCCTTGGAT
>probe:Drosophila_2:1641513_at:307:123; Interrogation_Position=1861; Antisense; AGCCCTTGGATGAGCGTGTACTTCT
>probe:Drosophila_2:1641513_at:623:515; Interrogation_Position=1876; Antisense; GTGTACTTCTTGACTCCCAAGTGAA
>probe:Drosophila_2:1641513_at:666:175; Interrogation_Position=1926; Antisense; AAACGAGAACTGCTGATGACCGGGC
>probe:Drosophila_2:1641513_at:142:523; Interrogation_Position=1962; Antisense; GTGGCCGCTCTCTACAAGAAGTCCA
>probe:Drosophila_2:1641513_at:541:609; Interrogation_Position=2021; Antisense; TGAGCAGATCCAGGGCTACTTGCAG
>probe:Drosophila_2:1641513_at:298:349; Interrogation_Position=2042; Antisense; GCAGGCCATTGGTTGCTAGGATGCA
>probe:Drosophila_2:1641513_at:562:37; Interrogation_Position=2075; Antisense; ATCGATGACCCTTCCCAAATTTGAA
>probe:Drosophila_2:1641513_at:534:555; Interrogation_Position=2167; Antisense; GGACCCGACAGCAAGCGACGAGCAG
>probe:Drosophila_2:1641513_at:538:281; Interrogation_Position=2209; Antisense; CTCCGCCGGAGCATTGTACAATTTA
>probe:Drosophila_2:1641513_at:262:487; Interrogation_Position=2321; Antisense; GTAGCCGAGCATCTGCAAACTGCAT

Paste this into a BLAST search page for me
AAGATCTTCGCCGAGAACGCCGAGTGTAGACCGTGATCATGTTCAACGCGGTTCAACGCGAGCTTTCCAGACGAGACGAGCGATTCGTGAGCCCTTGGATAGCCCTTGGATGAGCGTGTACTTCTGTGTACTTCTTGACTCCCAAGTGAAAAACGAGAACTGCTGATGACCGGGCGTGGCCGCTCTCTACAAGAAGTCCATGAGCAGATCCAGGGCTACTTGCAGGCAGGCCATTGGTTGCTAGGATGCAATCGATGACCCTTCCCAAATTTGAAGGACCCGACAGCAAGCGACGAGCAGCTCCGCCGGAGCATTGTACAATTTAGTAGCCGAGCATCTGCAAACTGCAT

Full Affymetrix probeset data:

Annotations for 1641513_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime