FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641519_at:

>probe:Drosophila_2:1641519_at:632:659; Interrogation_Position=102; Antisense; TAACGAGCTGTCGAGTCTCTACAAT
>probe:Drosophila_2:1641519_at:659:417; Interrogation_Position=148; Antisense; GAGCTGGCGTCCGTGAATCTGGATA
>probe:Drosophila_2:1641519_at:300:679; Interrogation_Position=171; Antisense; TAGGAGCTCCCTGATCGATGACTAT
>probe:Drosophila_2:1641519_at:622:41; Interrogation_Position=194; Antisense; ATCGTCTACTGCACGAGGTGTCGCA
>probe:Drosophila_2:1641519_at:659:335; Interrogation_Position=259; Antisense; GCTGCTCCAGCAGGACAACCAAAAT
>probe:Drosophila_2:1641519_at:536:151; Interrogation_Position=346; Antisense; ACATTTCCGATGCTCAACCATTTGA
>probe:Drosophila_2:1641519_at:344:553; Interrogation_Position=393; Antisense; GGAGCCGGAGACCATTTTCAACGAA
>probe:Drosophila_2:1641519_at:497:583; Interrogation_Position=44; Antisense; TGGCTTCCGATCCAAATTCGCGTAA
>probe:Drosophila_2:1641519_at:453:75; Interrogation_Position=455; Antisense; AGGAGGTAATGCAGCTGGAGCCCAA
>probe:Drosophila_2:1641519_at:172:587; Interrogation_Position=470; Antisense; TGGAGCCCAATGAGCGTCTGTTTCG
>probe:Drosophila_2:1641519_at:495:151; Interrogation_Position=527; Antisense; ACATGTTCATCAACGGCAATCGCAG
>probe:Drosophila_2:1641519_at:512:633; Interrogation_Position=572; Antisense; TCACCGCAATTATCCGTTTGGTCGA
>probe:Drosophila_2:1641519_at:224:537; Interrogation_Position=591; Antisense; GGTCGACCGCTCTAATGTGGCAAAA
>probe:Drosophila_2:1641519_at:554:161; Interrogation_Position=67; Antisense; AAATTGAAGTTTGCCGGCATTTGCA

Paste this into a BLAST search page for me
TAACGAGCTGTCGAGTCTCTACAATGAGCTGGCGTCCGTGAATCTGGATATAGGAGCTCCCTGATCGATGACTATATCGTCTACTGCACGAGGTGTCGCAGCTGCTCCAGCAGGACAACCAAAATACATTTCCGATGCTCAACCATTTGAGGAGCCGGAGACCATTTTCAACGAATGGCTTCCGATCCAAATTCGCGTAAAGGAGGTAATGCAGCTGGAGCCCAATGGAGCCCAATGAGCGTCTGTTTCGACATGTTCATCAACGGCAATCGCAGTCACCGCAATTATCCGTTTGGTCGAGGTCGACCGCTCTAATGTGGCAAAAAAATTGAAGTTTGCCGGCATTTGCA

Full Affymetrix probeset data:

Annotations for 1641519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720