FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641520_at:

>probe:Drosophila_2:1641520_at:537:217; Interrogation_Position=349; Antisense; AAGTACATGACGTTTCTGTGCGGCC
>probe:Drosophila_2:1641520_at:688:489; Interrogation_Position=387; Antisense; GTACTATACACTGGCGCTGACCTTT
>probe:Drosophila_2:1641520_at:613:129; Interrogation_Position=413; Antisense; ACCTCCTCCGATTGAGATCTCTAAG
>probe:Drosophila_2:1641520_at:213:21; Interrogation_Position=535; Antisense; ATATATCCGGTGCTTTTGGACCTGG
>probe:Drosophila_2:1641520_at:149:413; Interrogation_Position=553; Antisense; GACCTGGTCTATCCCAATTGGCTGA
>probe:Drosophila_2:1641520_at:389:717; Interrogation_Position=595; Antisense; TTCGTCGTAATCTATGCCTTTGTGG
>probe:Drosophila_2:1641520_at:210:407; Interrogation_Position=671; Antisense; GACTGGGTGCCTTCATGTTGGGATA
>probe:Drosophila_2:1641520_at:614:455; Interrogation_Position=705; Antisense; GATACATATCGTTTGGTTCCGGACC
>probe:Drosophila_2:1641520_at:98:471; Interrogation_Position=720; Antisense; GTTCCGGACCGACATCTGGGTGTAT
>probe:Drosophila_2:1641520_at:72:347; Interrogation_Position=758; Antisense; GCATCGCCTGGCAGCTGAGAGTAAT
>probe:Drosophila_2:1641520_at:52:693; Interrogation_Position=787; Antisense; TTTGTCCTTATCATGGTCCTCGGAT
>probe:Drosophila_2:1641520_at:317:13; Interrogation_Position=810; Antisense; ATTCATTTACTATCTCTTCGGCGAG
>probe:Drosophila_2:1641520_at:97:241; Interrogation_Position=841; Antisense; AATAACGTCTTGTGGCAGCGATCTA
>probe:Drosophila_2:1641520_at:644:121; Interrogation_Position=857; Antisense; AGCGATCTACTGGTGTCCACAGATG

Paste this into a BLAST search page for me
AAGTACATGACGTTTCTGTGCGGCCGTACTATACACTGGCGCTGACCTTTACCTCCTCCGATTGAGATCTCTAAGATATATCCGGTGCTTTTGGACCTGGGACCTGGTCTATCCCAATTGGCTGATTCGTCGTAATCTATGCCTTTGTGGGACTGGGTGCCTTCATGTTGGGATAGATACATATCGTTTGGTTCCGGACCGTTCCGGACCGACATCTGGGTGTATGCATCGCCTGGCAGCTGAGAGTAATTTTGTCCTTATCATGGTCCTCGGATATTCATTTACTATCTCTTCGGCGAGAATAACGTCTTGTGGCAGCGATCTAAGCGATCTACTGGTGTCCACAGATG

Full Affymetrix probeset data:

Annotations for 1641520_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720