Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641525_at:

>probe:Drosophila_2:1641525_at:228:701; Interrogation_Position=1040; Antisense; TTTTTTCCATCAAGGGCGATCGCAC
>probe:Drosophila_2:1641525_at:214:603; Interrogation_Position=1067; Antisense; TGTTGGCCTCCGTGAAGACAGATCC
>probe:Drosophila_2:1641525_at:412:95; Interrogation_Position=1086; Antisense; AGATCCCAAGGAGGTCAACGCCATT
>probe:Drosophila_2:1641525_at:70:275; Interrogation_Position=1107; Antisense; CATTGCTCAGACAGTGGCCGATAAA
>probe:Drosophila_2:1641525_at:118:705; Interrogation_Position=1178; Antisense; TTAATGACCACGCTACCCGAGTGAA
>probe:Drosophila_2:1641525_at:654:389; Interrogation_Position=1206; Antisense; GAAACCCCTGCTAAGTGCATTTGGA
>probe:Drosophila_2:1641525_at:565:555; Interrogation_Position=1228; Antisense; GGACGCACTGTTCCACTGAAGGATC
>probe:Drosophila_2:1641525_at:570:547; Interrogation_Position=1302; Antisense; GGATGATCTGCTGACCCGCGAGAAG
>probe:Drosophila_2:1641525_at:276:145; Interrogation_Position=1360; Antisense; ACTGCCCTGATCGATTTCTATCTGG
>probe:Drosophila_2:1641525_at:47:155; Interrogation_Position=1407; Antisense; ACAGTATCTCCTGCAGAGCGGTGAC
>probe:Drosophila_2:1641525_at:433:431; Interrogation_Position=1438; Antisense; GAGTCCAGCGCCAGTGAATCTGTGG
>probe:Drosophila_2:1641525_at:679:319; Interrogation_Position=1470; Antisense; GCCGCTCTACGAACTTCTGGGATTG
>probe:Drosophila_2:1641525_at:722:203; Interrogation_Position=1502; Antisense; AAGCCATTGATTGCCATTACGTTGA
>probe:Drosophila_2:1641525_at:141:461; Interrogation_Position=1525; Antisense; GATTAGTTAAATTCCCTGTTGTCTG

Paste this into a BLAST search page for me
TTTTTTCCATCAAGGGCGATCGCACTGTTGGCCTCCGTGAAGACAGATCCAGATCCCAAGGAGGTCAACGCCATTCATTGCTCAGACAGTGGCCGATAAATTAATGACCACGCTACCCGAGTGAAGAAACCCCTGCTAAGTGCATTTGGAGGACGCACTGTTCCACTGAAGGATCGGATGATCTGCTGACCCGCGAGAAGACTGCCCTGATCGATTTCTATCTGGACAGTATCTCCTGCAGAGCGGTGACGAGTCCAGCGCCAGTGAATCTGTGGGCCGCTCTACGAACTTCTGGGATTGAAGCCATTGATTGCCATTACGTTGAGATTAGTTAAATTCCCTGTTGTCTG

Full Affymetrix probeset data:

Annotations for 1641525_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime