Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641532_at:

>probe:Drosophila_2:1641532_at:677:617; Interrogation_Position=1684; Antisense; TGCAGCTGTTCCTGCCGATGGTGGA
>probe:Drosophila_2:1641532_at:100:97; Interrogation_Position=1717; Antisense; AGATCACCGGTACAATGCGCGGCGA
>probe:Drosophila_2:1641532_at:357:325; Interrogation_Position=1738; Antisense; GCGAGGGCGACAACGATCCCGTGTC
>probe:Drosophila_2:1641532_at:520:189; Interrogation_Position=1749; Antisense; AACGATCCCGTGTCCGAATTTATTG
>probe:Drosophila_2:1641532_at:433:295; Interrogation_Position=1763; Antisense; CGAATTTATTGTTCACTGCAAGGCG
>probe:Drosophila_2:1641532_at:499:615; Interrogation_Position=1779; Antisense; TGCAAGGCGCATTACACGACTGTAT
>probe:Drosophila_2:1641532_at:418:107; Interrogation_Position=1817; Antisense; AGAACGTGCTTTACAGGCGACTTCC
>probe:Drosophila_2:1641532_at:432:575; Interrogation_Position=1832; Antisense; GGCGACTTCCATTCAAAGACGACCT
>probe:Drosophila_2:1641532_at:603:409; Interrogation_Position=1849; Antisense; GACGACCTCAATTAAGCCCAATTTA
>probe:Drosophila_2:1641532_at:117:361; Interrogation_Position=1922; Antisense; GAAAAGTACCCTATTCTTCTATTAG
>probe:Drosophila_2:1641532_at:576:15; Interrogation_Position=1994; Antisense; ATTATAAGCATTTTTGCCGCTAAAA
>probe:Drosophila_2:1641532_at:250:319; Interrogation_Position=2009; Antisense; GCCGCTAAAATTTCACTAGGCTTTG
>probe:Drosophila_2:1641532_at:509:15; Interrogation_Position=2062; Antisense; ATTATATTCCTTACGCATTTGAGCT
>probe:Drosophila_2:1641532_at:686:345; Interrogation_Position=2076; Antisense; GCATTTGAGCTTTCATTGTTTTAAC

Paste this into a BLAST search page for me
TGCAGCTGTTCCTGCCGATGGTGGAAGATCACCGGTACAATGCGCGGCGAGCGAGGGCGACAACGATCCCGTGTCAACGATCCCGTGTCCGAATTTATTGCGAATTTATTGTTCACTGCAAGGCGTGCAAGGCGCATTACACGACTGTATAGAACGTGCTTTACAGGCGACTTCCGGCGACTTCCATTCAAAGACGACCTGACGACCTCAATTAAGCCCAATTTAGAAAAGTACCCTATTCTTCTATTAGATTATAAGCATTTTTGCCGCTAAAAGCCGCTAAAATTTCACTAGGCTTTGATTATATTCCTTACGCATTTGAGCTGCATTTGAGCTTTCATTGTTTTAAC

Full Affymetrix probeset data:

Annotations for 1641532_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime