FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641534_at:

>probe:Drosophila_2:1641534_at:180:387; Interrogation_Position=1011; Antisense; GAAAATTTGACTCCACAGTTCTGTG
>probe:Drosophila_2:1641534_at:722:191; Interrogation_Position=532; Antisense; AACGACATTTCCGTGGTACGATTGA
>probe:Drosophila_2:1641534_at:43:487; Interrogation_Position=547; Antisense; GTACGATTGAGTCGACCCGTAACCT
>probe:Drosophila_2:1641534_at:23:307; Interrogation_Position=569; Antisense; CCTTCAACGATTACAAGCATCCGGC
>probe:Drosophila_2:1641534_at:716:633; Interrogation_Position=599; Antisense; TACCCTTCGACGATGGGCGATTGGG
>probe:Drosophila_2:1641534_at:37:339; Interrogation_Position=702; Antisense; GCTCTACAACTATGGAACGCGCTGC
>probe:Drosophila_2:1641534_at:284:543; Interrogation_Position=763; Antisense; GGATATAATGCTACCACCCAACTGT
>probe:Drosophila_2:1641534_at:472:347; Interrogation_Position=788; Antisense; GCATCGGGTCCAACGAGCACAAGGA
>probe:Drosophila_2:1641534_at:372:535; Interrogation_Position=840; Antisense; GGTGCTCATCTATCACATGGACTAC
>probe:Drosophila_2:1641534_at:487:673; Interrogation_Position=862; Antisense; TACCCCTGCATGTACCATGTGATGG
>probe:Drosophila_2:1641534_at:523:483; Interrogation_Position=887; Antisense; GTATCACATCCATCGGAGTGGCCTG
>probe:Drosophila_2:1641534_at:615:297; Interrogation_Position=930; Antisense; CGCGATGTACACACGGGTTCACTTC
>probe:Drosophila_2:1641534_at:554:529; Interrogation_Position=944; Antisense; GGGTTCACTTCTACCTGGACTGGAT
>probe:Drosophila_2:1641534_at:129:407; Interrogation_Position=961; Antisense; GACTGGATTAAGCAGCAGCTGGCCA

Paste this into a BLAST search page for me
GAAAATTTGACTCCACAGTTCTGTGAACGACATTTCCGTGGTACGATTGAGTACGATTGAGTCGACCCGTAACCTCCTTCAACGATTACAAGCATCCGGCTACCCTTCGACGATGGGCGATTGGGGCTCTACAACTATGGAACGCGCTGCGGATATAATGCTACCACCCAACTGTGCATCGGGTCCAACGAGCACAAGGAGGTGCTCATCTATCACATGGACTACTACCCCTGCATGTACCATGTGATGGGTATCACATCCATCGGAGTGGCCTGCGCGATGTACACACGGGTTCACTTCGGGTTCACTTCTACCTGGACTGGATGACTGGATTAAGCAGCAGCTGGCCA

Full Affymetrix probeset data:

Annotations for 1641534_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720