FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641535_at:

>probe:Drosophila_2:1641535_at:210:539; Interrogation_Position=256; Antisense; GGTTTTTCCCTATGCTTTTATTGCT
>probe:Drosophila_2:1641535_at:517:689; Interrogation_Position=274; Antisense; TATTGCTGTACATATGGCGCCATAA
>probe:Drosophila_2:1641535_at:262:175; Interrogation_Position=318; Antisense; AAAGCCTTCTTATTTTGCTCCTGGC
>probe:Drosophila_2:1641535_at:88:555; Interrogation_Position=340; Antisense; GGCAGTTGGGCCCTGAAGATCTATT
>probe:Drosophila_2:1641535_at:150:665; Interrogation_Position=376; Antisense; TACACAACTGTAGTCCTGGCCATGA
>probe:Drosophila_2:1641535_at:543:57; Interrogation_Position=397; Antisense; ATGATGATCACCTTGGTCTTCTGGG
>probe:Drosophila_2:1641535_at:297:609; Interrogation_Position=456; Antisense; TGAGCTGTACAACTTGTGGGCCCAT
>probe:Drosophila_2:1641535_at:133:49; Interrogation_Position=479; Antisense; ATGCGTTTAACTCCATTTGCCTGGT
>probe:Drosophila_2:1641535_at:359:19; Interrogation_Position=493; Antisense; ATTTGCCTGGTCTTCGATTGCTTTA
>probe:Drosophila_2:1641535_at:289:15; Interrogation_Position=538; Antisense; ATTATGCATTTCGTGTATCCCTTTA
>probe:Drosophila_2:1641535_at:362:695; Interrogation_Position=559; Antisense; TTTACCGCTGGCATTACCTATGGAG
>probe:Drosophila_2:1641535_at:125:275; Interrogation_Position=591; Antisense; CTTGATTTACTTTTGGGCTGGCGGC
>probe:Drosophila_2:1641535_at:669:37; Interrogation_Position=640; Antisense; ATCTACTTCATCTTGGACTGGGAGC
>probe:Drosophila_2:1641535_at:25:397; Interrogation_Position=790; Antisense; GAAATTCCAGCTACTACTGCTTCAC

Paste this into a BLAST search page for me
GGTTTTTCCCTATGCTTTTATTGCTTATTGCTGTACATATGGCGCCATAAAAAGCCTTCTTATTTTGCTCCTGGCGGCAGTTGGGCCCTGAAGATCTATTTACACAACTGTAGTCCTGGCCATGAATGATGATCACCTTGGTCTTCTGGGTGAGCTGTACAACTTGTGGGCCCATATGCGTTTAACTCCATTTGCCTGGTATTTGCCTGGTCTTCGATTGCTTTAATTATGCATTTCGTGTATCCCTTTATTTACCGCTGGCATTACCTATGGAGCTTGATTTACTTTTGGGCTGGCGGCATCTACTTCATCTTGGACTGGGAGCGAAATTCCAGCTACTACTGCTTCAC

Full Affymetrix probeset data:

Annotations for 1641535_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720