Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641539_a_at:

>probe:Drosophila_2:1641539_a_at:59:313; Interrogation_Position=157; Antisense; GCCAACATTCCGTACATAGTGTCCA
>probe:Drosophila_2:1641539_a_at:553:25; Interrogation_Position=172; Antisense; ATAGTGTCCATCCAACTGTACGGCA
>probe:Drosophila_2:1641539_a_at:101:197; Interrogation_Position=240; Antisense; AACGGCTGGCCATTGTCTGAACGGA
>probe:Drosophila_2:1641539_a_at:611:627; Interrogation_Position=266; Antisense; TGCCACATCGCCTGCTGAAAGTTAA
>probe:Drosophila_2:1641539_a_at:120:563; Interrogation_Position=298; Antisense; GGAACGTCGCGCTACCGAAAAGATG
>probe:Drosophila_2:1641539_a_at:640:411; Interrogation_Position=343; Antisense; GACCTGCAAGTCCACGAGAATTTCA
>probe:Drosophila_2:1641539_a_at:288:421; Interrogation_Position=358; Antisense; GAGAATTTCAATCCCAAGACCATGG
>probe:Drosophila_2:1641539_a_at:465:69; Interrogation_Position=491; Antisense; AGGCCATTCCCATAAACCCAGAGAG
>probe:Drosophila_2:1641539_a_at:446:709; Interrogation_Position=557; Antisense; TTAAGTCCATGAATGGTCCTCCCTC
>probe:Drosophila_2:1641539_a_at:683:153; Interrogation_Position=584; Antisense; ACAGTCTGAGATATGCCCGAGTGCC
>probe:Drosophila_2:1641539_a_at:252:433; Interrogation_Position=602; Antisense; GAGTGCCGATCGTGAATCAGACCGC
>probe:Drosophila_2:1641539_a_at:305:317; Interrogation_Position=625; Antisense; GCCTGCAGGAACCTACTGGGCAAAA
>probe:Drosophila_2:1641539_a_at:682:61; Interrogation_Position=63; Antisense; ATGGTGGAAATTGCTTCTCCTCCAG
>probe:Drosophila_2:1641539_a_at:678:67; Interrogation_Position=86; Antisense; AGGCTTCTGGGTGTCTATCTCTGGA

Paste this into a BLAST search page for me
GCCAACATTCCGTACATAGTGTCCAATAGTGTCCATCCAACTGTACGGCAAACGGCTGGCCATTGTCTGAACGGATGCCACATCGCCTGCTGAAAGTTAAGGAACGTCGCGCTACCGAAAAGATGGACCTGCAAGTCCACGAGAATTTCAGAGAATTTCAATCCCAAGACCATGGAGGCCATTCCCATAAACCCAGAGAGTTAAGTCCATGAATGGTCCTCCCTCACAGTCTGAGATATGCCCGAGTGCCGAGTGCCGATCGTGAATCAGACCGCGCCTGCAGGAACCTACTGGGCAAAAATGGTGGAAATTGCTTCTCCTCCAGAGGCTTCTGGGTGTCTATCTCTGGA

Full Affymetrix probeset data:

Annotations for 1641539_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime