Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641541_a_at:

>probe:Drosophila_2:1641541_a_at:156:91; Interrogation_Position=131; Antisense; AGTACGCATTCTGTCTGGTCCGAAG
>probe:Drosophila_2:1641541_a_at:115:501; Interrogation_Position=143; Antisense; GTCTGGTCCGAAGTCGGTACACAAA
>probe:Drosophila_2:1641541_a_at:331:549; Interrogation_Position=195; Antisense; GGAGGAACTGGCTCGTACGCATCCA
>probe:Drosophila_2:1641541_a_at:522:269; Interrogation_Position=214; Antisense; CATCCAGATGGAAGGCGTGACTATA
>probe:Drosophila_2:1641541_a_at:306:275; Interrogation_Position=247; Antisense; CTTGCGTTTGGTAATGCTCGTATCA
>probe:Drosophila_2:1641541_a_at:722:683; Interrogation_Position=267; Antisense; TATCAAGGAGTATACGTCTGGCTTA
>probe:Drosophila_2:1641541_a_at:427:499; Interrogation_Position=282; Antisense; GTCTGGCTTAAAATACTGCCGAGCT
>probe:Drosophila_2:1641541_a_at:513:163; Interrogation_Position=292; Antisense; AAATACTGCCGAGCTTTTCTTGACA
>probe:Drosophila_2:1641541_a_at:29:319; Interrogation_Position=299; Antisense; GCCGAGCTTTTCTTGACATCGAGTC
>probe:Drosophila_2:1641541_a_at:479:495; Interrogation_Position=321; Antisense; GTCAAATGATCAAGTTCGCTCCCTA
>probe:Drosophila_2:1641541_a_at:17:447; Interrogation_Position=328; Antisense; GATCAAGTTCGCTCCCTAGAGGAAT
>probe:Drosophila_2:1641541_a_at:396:553; Interrogation_Position=406; Antisense; GGAGCAGCTTTAGTACTTGGCGGAA
>probe:Drosophila_2:1641541_a_at:90:491; Interrogation_Position=418; Antisense; GTACTTGGCGGAATATTAGGACTTG
>probe:Drosophila_2:1641541_a_at:293:557; Interrogation_Position=436; Antisense; GGACTTGGCATTGCTATGGCTAGAA

Paste this into a BLAST search page for me
AGTACGCATTCTGTCTGGTCCGAAGGTCTGGTCCGAAGTCGGTACACAAAGGAGGAACTGGCTCGTACGCATCCACATCCAGATGGAAGGCGTGACTATACTTGCGTTTGGTAATGCTCGTATCATATCAAGGAGTATACGTCTGGCTTAGTCTGGCTTAAAATACTGCCGAGCTAAATACTGCCGAGCTTTTCTTGACAGCCGAGCTTTTCTTGACATCGAGTCGTCAAATGATCAAGTTCGCTCCCTAGATCAAGTTCGCTCCCTAGAGGAATGGAGCAGCTTTAGTACTTGGCGGAAGTACTTGGCGGAATATTAGGACTTGGGACTTGGCATTGCTATGGCTAGAA

Full Affymetrix probeset data:

Annotations for 1641541_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime