FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641542_at:

>probe:Drosophila_2:1641542_at:698:539; Interrogation_Position=3932; Antisense; GGTATACGAGACATCGCTCCTACAG
>probe:Drosophila_2:1641542_at:684:189; Interrogation_Position=3976; Antisense; AACATTTACACCATCAACCACTACT
>probe:Drosophila_2:1641542_at:337:127; Interrogation_Position=3992; Antisense; ACCACTACTACAACTGGAGCAGCAG
>probe:Drosophila_2:1641542_at:350:263; Interrogation_Position=4011; Antisense; CAGCAGCAGCTTTGTTTGATAATAC
>probe:Drosophila_2:1641542_at:217:359; Interrogation_Position=4037; Antisense; GCAACAATGTCTTCTAATCGACCAT
>probe:Drosophila_2:1641542_at:683:413; Interrogation_Position=4056; Antisense; GACCATTTACTAACCAATTCCAATC
>probe:Drosophila_2:1641542_at:614:245; Interrogation_Position=4071; Antisense; AATTCCAATCGATTGATCCCACTTC
>probe:Drosophila_2:1641542_at:412:465; Interrogation_Position=4081; Antisense; GATTGATCCCACTTCAAACGACGCA
>probe:Drosophila_2:1641542_at:187:157; Interrogation_Position=4129; Antisense; ACACCAATACCAACATCACCGAAAA
>probe:Drosophila_2:1641542_at:523:25; Interrogation_Position=4173; Antisense; ATAACACTCTGAACGAAAACCACAC
>probe:Drosophila_2:1641542_at:6:19; Interrogation_Position=4233; Antisense; CGTCTTGTTGTACCAAAACCATCGC
>probe:Drosophila_2:1641542_at:175:175; Interrogation_Position=4248; Antisense; AAACCATCGCCACAGATAGCCAAGT
>probe:Drosophila_2:1641542_at:57:279; Interrogation_Position=4489; Antisense; CTCTTCCGGTGAGTACGCACTATTA
>probe:Drosophila_2:1641542_at:175:431; Interrogation_Position=4499; Antisense; GAGTACGCACTATTATTATTTATTT

Paste this into a BLAST search page for me
GGTATACGAGACATCGCTCCTACAGAACATTTACACCATCAACCACTACTACCACTACTACAACTGGAGCAGCAGCAGCAGCAGCTTTGTTTGATAATACGCAACAATGTCTTCTAATCGACCATGACCATTTACTAACCAATTCCAATCAATTCCAATCGATTGATCCCACTTCGATTGATCCCACTTCAAACGACGCAACACCAATACCAACATCACCGAAAAATAACACTCTGAACGAAAACCACACCGTCTTGTTGTACCAAAACCATCGCAAACCATCGCCACAGATAGCCAAGTCTCTTCCGGTGAGTACGCACTATTAGAGTACGCACTATTATTATTTATTT

Full Affymetrix probeset data:

Annotations for 1641542_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720