FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641544_at:

>probe:Drosophila_2:1641544_at:110:147; Interrogation_Position=419; Antisense; ACTACCCGGAGGAGTGCTGTCCAAA
>probe:Drosophila_2:1641544_at:249:477; Interrogation_Position=466; Antisense; GTTTTGTACTATACACCGTCGGACA
>probe:Drosophila_2:1641544_at:87:397; Interrogation_Position=487; Antisense; GACAAGTGCCGGGAGTTCCAGCGCA
>probe:Drosophila_2:1641544_at:616:227; Interrogation_Position=534; Antisense; AATGGTACCGAAGCGGGTCTGCTGC
>probe:Drosophila_2:1641544_at:140:81; Interrogation_Position=581; Antisense; AGGTCCTGCGGCGAGATTTGCCCAT
>probe:Drosophila_2:1641544_at:682:449; Interrogation_Position=614; Antisense; GATCCGCTTGTCTCGCAGAACATGA
>probe:Drosophila_2:1641544_at:411:157; Interrogation_Position=671; Antisense; ACAAAGGTTGCATGCGTATCCGTAT
>probe:Drosophila_2:1641544_at:700:681; Interrogation_Position=687; Antisense; TATCCGTATGCCGTGTTGTCGAACC
>probe:Drosophila_2:1641544_at:499:303; Interrogation_Position=743; Antisense; CCGGTCCTTCCGATTGCGAGAAGAT
>probe:Drosophila_2:1641544_at:102:423; Interrogation_Position=760; Antisense; GAGAAGATCAAGTGCCCGTTCCCGA
>probe:Drosophila_2:1641544_at:559:301; Interrogation_Position=781; Antisense; CCGAGTTACTCCGAATGCGTTCAGG
>probe:Drosophila_2:1641544_at:412:233; Interrogation_Position=794; Antisense; AATGCGTTCAGGAGGATCCCGCTGT
>probe:Drosophila_2:1641544_at:157:169; Interrogation_Position=855; Antisense; AAAGGCGTCTCAGTGCGAGCAGATC
>probe:Drosophila_2:1641544_at:575:397; Interrogation_Position=907; Antisense; GACATAAGCATCTGGCCGTGTACTT

Paste this into a BLAST search page for me
ACTACCCGGAGGAGTGCTGTCCAAAGTTTTGTACTATACACCGTCGGACAGACAAGTGCCGGGAGTTCCAGCGCAAATGGTACCGAAGCGGGTCTGCTGCAGGTCCTGCGGCGAGATTTGCCCATGATCCGCTTGTCTCGCAGAACATGAACAAAGGTTGCATGCGTATCCGTATTATCCGTATGCCGTGTTGTCGAACCCCGGTCCTTCCGATTGCGAGAAGATGAGAAGATCAAGTGCCCGTTCCCGACCGAGTTACTCCGAATGCGTTCAGGAATGCGTTCAGGAGGATCCCGCTGTAAAGGCGTCTCAGTGCGAGCAGATCGACATAAGCATCTGGCCGTGTACTT

Full Affymetrix probeset data:

Annotations for 1641544_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720