FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641545_at:

>probe:Drosophila_2:1641545_at:576:137; Interrogation_Position=1013; Antisense; ACGAGATATGGGATTGCGACTGCAC
>probe:Drosophila_2:1641545_at:193:11; Interrogation_Position=1093; Antisense; ATTCTGCGACGCAAGTACACTGCAC
>probe:Drosophila_2:1641545_at:648:509; Interrogation_Position=1189; Antisense; GTGCATCCTCGAAAAGTGCTGCCCA
>probe:Drosophila_2:1641545_at:283:49; Interrogation_Position=1213; Antisense; ATCCACCATCATGCCTTGAAGAGCA
>probe:Drosophila_2:1641545_at:456:383; Interrogation_Position=1240; Antisense; GAACGTGGACAGTTATCGCTGGTCT
>probe:Drosophila_2:1641545_at:203:705; Interrogation_Position=1252; Antisense; TTATCGCTGGTCTTGCGTCAGGAAC
>probe:Drosophila_2:1641545_at:561:73; Interrogation_Position=1271; Antisense; AGGAACCATTCCAGTCACTTCTGAG
>probe:Drosophila_2:1641545_at:42:287; Interrogation_Position=1301; Antisense; CGGCTACTGCCGCAAATCAGTTACA
>probe:Drosophila_2:1641545_at:587:147; Interrogation_Position=1328; Antisense; ACTTTGTGGAGTTGCCATCGCCCAG
>probe:Drosophila_2:1641545_at:357:335; Interrogation_Position=1362; Antisense; GCTGCACAGCGGTTTGGGTGATTCT
>probe:Drosophila_2:1641545_at:269:521; Interrogation_Position=1388; Antisense; GTGGCATCCAGGAGCTGTGCACCAA
>probe:Drosophila_2:1641545_at:129:163; Interrogation_Position=1448; Antisense; AAATGAGCCGGCGATTCGATAATTT
>probe:Drosophila_2:1641545_at:11:117; Interrogation_Position=1481; Antisense; AGCATTTGACGCTGCGCTATTCTCG
>probe:Drosophila_2:1641545_at:537:635; Interrogation_Position=1503; Antisense; TCGTTCGCAGAGTGATCGCTATTTA

Paste this into a BLAST search page for me
ACGAGATATGGGATTGCGACTGCACATTCTGCGACGCAAGTACACTGCACGTGCATCCTCGAAAAGTGCTGCCCAATCCACCATCATGCCTTGAAGAGCAGAACGTGGACAGTTATCGCTGGTCTTTATCGCTGGTCTTGCGTCAGGAACAGGAACCATTCCAGTCACTTCTGAGCGGCTACTGCCGCAAATCAGTTACAACTTTGTGGAGTTGCCATCGCCCAGGCTGCACAGCGGTTTGGGTGATTCTGTGGCATCCAGGAGCTGTGCACCAAAAATGAGCCGGCGATTCGATAATTTAGCATTTGACGCTGCGCTATTCTCGTCGTTCGCAGAGTGATCGCTATTTA

Full Affymetrix probeset data:

Annotations for 1641545_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720