Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641548_at:

>probe:Drosophila_2:1641548_at:420:585; Interrogation_Position=2858; Antisense; TGGAGAAGGCCATCAGCGATAAGCT
>probe:Drosophila_2:1641548_at:44:263; Interrogation_Position=2871; Antisense; CAGCGATAAGCTGGCCGAGTCGAGC
>probe:Drosophila_2:1641548_at:429:103; Interrogation_Position=2903; Antisense; AGACTGCAGCAATTGTTACTCGATT
>probe:Drosophila_2:1641548_at:307:475; Interrogation_Position=2917; Antisense; GTTACTCGATTGCAATCCGTACTGC
>probe:Drosophila_2:1641548_at:296:413; Interrogation_Position=2982; Antisense; GACCAAGCCACTGGGTGCGGATCGT
>probe:Drosophila_2:1641548_at:325:623; Interrogation_Position=2997; Antisense; TGCGGATCGTCCTTCGGAGACCGAG
>probe:Drosophila_2:1641548_at:238:425; Interrogation_Position=3013; Antisense; GAGACCGAGCAAATTACTCCCATTT
>probe:Drosophila_2:1641548_at:200:263; Interrogation_Position=3087; Antisense; CAGCAGTAACAACGTGGATGGCCAC
>probe:Drosophila_2:1641548_at:201:379; Interrogation_Position=3112; Antisense; GAAGCCAACATCACAACGGAGCAGC
>probe:Drosophila_2:1641548_at:216:335; Interrogation_Position=3148; Antisense; GCTGCCGCCAAGACGAACAATGTTG
>probe:Drosophila_2:1641548_at:137:671; Interrogation_Position=3183; Antisense; TACGACCACATAAATGCACTTCCTC
>probe:Drosophila_2:1641548_at:48:129; Interrogation_Position=3208; Antisense; ACCACACCATACATCATTCAAGCGA
>probe:Drosophila_2:1641548_at:162:177; Interrogation_Position=3257; Antisense; AAACGCCTTTGATTTGCTCTTTGGT
>probe:Drosophila_2:1641548_at:349:671; Interrogation_Position=3332; Antisense; TACGTACATATATAACAGGCTGCAT

Paste this into a BLAST search page for me
TGGAGAAGGCCATCAGCGATAAGCTCAGCGATAAGCTGGCCGAGTCGAGCAGACTGCAGCAATTGTTACTCGATTGTTACTCGATTGCAATCCGTACTGCGACCAAGCCACTGGGTGCGGATCGTTGCGGATCGTCCTTCGGAGACCGAGGAGACCGAGCAAATTACTCCCATTTCAGCAGTAACAACGTGGATGGCCACGAAGCCAACATCACAACGGAGCAGCGCTGCCGCCAAGACGAACAATGTTGTACGACCACATAAATGCACTTCCTCACCACACCATACATCATTCAAGCGAAAACGCCTTTGATTTGCTCTTTGGTTACGTACATATATAACAGGCTGCAT

Full Affymetrix probeset data:

Annotations for 1641548_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime