FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641549_at:

>probe:Drosophila_2:1641549_at:242:137; Interrogation_Position=165; Antisense; ACGACACCAGTTCTTTGTGCGGAGC
>probe:Drosophila_2:1641549_at:151:597; Interrogation_Position=180; Antisense; TGTGCGGAGCCCCTGAAGAAAAAGA
>probe:Drosophila_2:1641549_at:59:109; Interrogation_Position=286; Antisense; AGAATGCCCGTCAGCTGAAGCCCGT
>probe:Drosophila_2:1641549_at:353:203; Interrogation_Position=303; Antisense; AAGCCCGTGGATGAACTGGAGGTTC
>probe:Drosophila_2:1641549_at:690:469; Interrogation_Position=324; Antisense; GTTCCACTGGAGCTCATCGACGAAA
>probe:Drosophila_2:1641549_at:690:195; Interrogation_Position=355; Antisense; AACGGCAGCGGAAGCTAGCTCCACT
>probe:Drosophila_2:1641549_at:346:285; Interrogation_Position=378; Antisense; CTGACCATCGACCAGTTGGAGGAAC
>probe:Drosophila_2:1641549_at:464:383; Interrogation_Position=399; Antisense; GAACGTGCTCTCCTCAAGAAGCAGT
>probe:Drosophila_2:1641549_at:184:85; Interrogation_Position=421; Antisense; AGTGGGCGCACTACAAGCACGACGA
>probe:Drosophila_2:1641549_at:277:417; Interrogation_Position=444; Antisense; GAGCGCGTAGCAGACTTTCAGATCA
>probe:Drosophila_2:1641549_at:583:323; Interrogation_Position=515; Antisense; GCGCGAGTCCGAGGAGCTCTACCAG
>probe:Drosophila_2:1641549_at:2:223; Interrogation_Position=609; Antisense; AAGGATTACGTCAGTCCCGATGGCG
>probe:Drosophila_2:1641549_at:135:405; Interrogation_Position=633; Antisense; GACTACCTGCACCAATCCATGAAGT
>probe:Drosophila_2:1641549_at:516:433; Interrogation_Position=670; Antisense; GAGGCGTGTAAGTTCCGGATGTTAA

Paste this into a BLAST search page for me
ACGACACCAGTTCTTTGTGCGGAGCTGTGCGGAGCCCCTGAAGAAAAAGAAGAATGCCCGTCAGCTGAAGCCCGTAAGCCCGTGGATGAACTGGAGGTTCGTTCCACTGGAGCTCATCGACGAAAAACGGCAGCGGAAGCTAGCTCCACTCTGACCATCGACCAGTTGGAGGAACGAACGTGCTCTCCTCAAGAAGCAGTAGTGGGCGCACTACAAGCACGACGAGAGCGCGTAGCAGACTTTCAGATCAGCGCGAGTCCGAGGAGCTCTACCAGAAGGATTACGTCAGTCCCGATGGCGGACTACCTGCACCAATCCATGAAGTGAGGCGTGTAAGTTCCGGATGTTAA

Full Affymetrix probeset data:

Annotations for 1641549_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720