Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641552_at:

>probe:Drosophila_2:1641552_at:174:461; Interrogation_Position=1699; Antisense; GATTTCAAGCTGCAGGCTGACATCA
>probe:Drosophila_2:1641552_at:68:229; Interrogation_Position=1738; Antisense; AATGGATTCAATGTCTCGTTGGAGA
>probe:Drosophila_2:1641552_at:375:585; Interrogation_Position=1757; Antisense; TGGAGAAGCGTCAGTACGCCACGGT
>probe:Drosophila_2:1641552_at:508:311; Interrogation_Position=1774; Antisense; GCCACGGTGGCCTAGAATCCAGAAA
>probe:Drosophila_2:1641552_at:615:105; Interrogation_Position=1794; Antisense; AGAAATCTAGGACCCCGACTACACA
>probe:Drosophila_2:1641552_at:439:391; Interrogation_Position=1836; Antisense; GAAACCGGAATCCAGCCCTGTATAT
>probe:Drosophila_2:1641552_at:120:365; Interrogation_Position=1928; Antisense; GAATAAGAACCCAACGCACAAGCCA
>probe:Drosophila_2:1641552_at:282:357; Interrogation_Position=1943; Antisense; GCACAAGCCAGCCAGAGAGTCAATT
>probe:Drosophila_2:1641552_at:646:601; Interrogation_Position=2025; Antisense; TGTTGGTCTTTAGCGAGTGGTGCCC
>probe:Drosophila_2:1641552_at:712:433; Interrogation_Position=2039; Antisense; GAGTGGTGCCCCTATATAATGTATA
>probe:Drosophila_2:1641552_at:441:711; Interrogation_Position=2095; Antisense; TTCAACGCAACTGTTTGTGCTCTTC
>probe:Drosophila_2:1641552_at:24:597; Interrogation_Position=2110; Antisense; TGTGCTCTTCACCTTTTTAGTACTC
>probe:Drosophila_2:1641552_at:213:665; Interrogation_Position=2130; Antisense; TACTCCTACTTTTACCACTATCTAT
>probe:Drosophila_2:1641552_at:192:73; Interrogation_Position=2262; Antisense; AGGCACGTAGCCGATAGAGCTGCAA

Paste this into a BLAST search page for me
GATTTCAAGCTGCAGGCTGACATCAAATGGATTCAATGTCTCGTTGGAGATGGAGAAGCGTCAGTACGCCACGGTGCCACGGTGGCCTAGAATCCAGAAAAGAAATCTAGGACCCCGACTACACAGAAACCGGAATCCAGCCCTGTATATGAATAAGAACCCAACGCACAAGCCAGCACAAGCCAGCCAGAGAGTCAATTTGTTGGTCTTTAGCGAGTGGTGCCCGAGTGGTGCCCCTATATAATGTATATTCAACGCAACTGTTTGTGCTCTTCTGTGCTCTTCACCTTTTTAGTACTCTACTCCTACTTTTACCACTATCTATAGGCACGTAGCCGATAGAGCTGCAA

Full Affymetrix probeset data:

Annotations for 1641552_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime