FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641553_at:

>probe:Drosophila_2:1641553_at:69:677; Interrogation_Position=448; Antisense; TATGATCGTCGTCCCTACGGTGTGG
>probe:Drosophila_2:1641553_at:687:413; Interrogation_Position=496; Antisense; GAGCAGGGACCACATATCTACCAGG
>probe:Drosophila_2:1641553_at:294:23; Interrogation_Position=509; Antisense; ATATCTACCAGGTGATGCCCACGGC
>probe:Drosophila_2:1641553_at:312:139; Interrogation_Position=529; Antisense; ACGGCCAATGTGCTCAACTGCAAGG
>probe:Drosophila_2:1641553_at:665:227; Interrogation_Position=555; Antisense; AATGGCCATTGGATCTCGTTCGCAG
>probe:Drosophila_2:1641553_at:433:433; Interrogation_Position=579; Antisense; GAGTGCTCGCACATATCTGGAGCGA
>probe:Drosophila_2:1641553_at:211:61; Interrogation_Position=645; Antisense; ATGTCATGCCATTCAGGCCATTCGA
>probe:Drosophila_2:1641553_at:530:305; Interrogation_Position=662; Antisense; CCATTCGAGGATCGTTGGGTTCCGA
>probe:Drosophila_2:1641553_at:260:591; Interrogation_Position=782; Antisense; TGGTCAAGGCTATGGATCCACCTCT
>probe:Drosophila_2:1641553_at:398:555; Interrogation_Position=813; Antisense; GGACCACGATCCTCTATCCGAGGAG
>probe:Drosophila_2:1641553_at:418:411; Interrogation_Position=869; Antisense; GACCGAGTAGCAGTGGAGTTCCACC
>probe:Drosophila_2:1641553_at:238:551; Interrogation_Position=883; Antisense; GGAGTTCCACCCAATGATACATCTG
>probe:Drosophila_2:1641553_at:532:455; Interrogation_Position=898; Antisense; GATACATCTGACATGGAAACCACTG
>probe:Drosophila_2:1641553_at:339:331; Interrogation_Position=932; Antisense; GCGGCAGTGACGCACATTGATCTAA

Paste this into a BLAST search page for me
TATGATCGTCGTCCCTACGGTGTGGGAGCAGGGACCACATATCTACCAGGATATCTACCAGGTGATGCCCACGGCACGGCCAATGTGCTCAACTGCAAGGAATGGCCATTGGATCTCGTTCGCAGGAGTGCTCGCACATATCTGGAGCGAATGTCATGCCATTCAGGCCATTCGACCATTCGAGGATCGTTGGGTTCCGATGGTCAAGGCTATGGATCCACCTCTGGACCACGATCCTCTATCCGAGGAGGACCGAGTAGCAGTGGAGTTCCACCGGAGTTCCACCCAATGATACATCTGGATACATCTGACATGGAAACCACTGGCGGCAGTGACGCACATTGATCTAA

Full Affymetrix probeset data:

Annotations for 1641553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720