FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641554_at:

>probe:Drosophila_2:1641554_at:585:171; Interrogation_Position=2032; Antisense; AAAGCAGTCGATTGCTCCACATGGA
>probe:Drosophila_2:1641554_at:538:99; Interrogation_Position=2056; Antisense; AGAGCTTATACGAAGTGCCGTGACT
>probe:Drosophila_2:1641554_at:316:317; Interrogation_Position=2072; Antisense; GCCGTGACTGATTTAATTGCCCTTT
>probe:Drosophila_2:1641554_at:167:7; Interrogation_Position=2087; Antisense; ATTGCCCTTTATGCCAATTTGCCAC
>probe:Drosophila_2:1641554_at:530:243; Interrogation_Position=2102; Antisense; AATTTGCCACCGAATGCCAGTGACC
>probe:Drosophila_2:1641554_at:492:707; Interrogation_Position=2142; Antisense; TTAAACTGCTAACCCGCCAGAACAT
>probe:Drosophila_2:1641554_at:335:265; Interrogation_Position=2159; Antisense; CAGAACATTCTCATCCAGCACGAGT
>probe:Drosophila_2:1641554_at:591:365; Interrogation_Position=2188; Antisense; GAATCTGCAGAAAGCCATCGAGGCG
>probe:Drosophila_2:1641554_at:477:469; Interrogation_Position=2296; Antisense; GTTGCAGTTCTATTGAGACGCCCAA
>probe:Drosophila_2:1641554_at:149:425; Interrogation_Position=2310; Antisense; GAGACGCCCAAAACACAATCATCGA
>probe:Drosophila_2:1641554_at:628:475; Interrogation_Position=2342; Antisense; GTTTAAACTCACTCACTCTTTTTTG
>probe:Drosophila_2:1641554_at:482:371; Interrogation_Position=2366; Antisense; GAAGTATTAACCGACCACTTTAGTG
>probe:Drosophila_2:1641554_at:1:149; Interrogation_Position=2382; Antisense; ACTTTAGTGCCCTGCTGACTAACAA
>probe:Drosophila_2:1641554_at:584:361; Interrogation_Position=2398; Antisense; GACTAACAAAAGTGCTTCCGCCAAA

Paste this into a BLAST search page for me
AAAGCAGTCGATTGCTCCACATGGAAGAGCTTATACGAAGTGCCGTGACTGCCGTGACTGATTTAATTGCCCTTTATTGCCCTTTATGCCAATTTGCCACAATTTGCCACCGAATGCCAGTGACCTTAAACTGCTAACCCGCCAGAACATCAGAACATTCTCATCCAGCACGAGTGAATCTGCAGAAAGCCATCGAGGCGGTTGCAGTTCTATTGAGACGCCCAAGAGACGCCCAAAACACAATCATCGAGTTTAAACTCACTCACTCTTTTTTGGAAGTATTAACCGACCACTTTAGTGACTTTAGTGCCCTGCTGACTAACAAGACTAACAAAAGTGCTTCCGCCAAA

Full Affymetrix probeset data:

Annotations for 1641554_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720