FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641555_at:

>probe:Drosophila_2:1641555_at:379:45; Interrogation_Position=165; Antisense; ATCCTCCACTTGTTTTGGTCGGAAT
>probe:Drosophila_2:1641555_at:26:379; Interrogation_Position=198; Antisense; GAAGCTAGCTGAGGAGGCATCCCAT
>probe:Drosophila_2:1641555_at:338:439; Interrogation_Position=211; Antisense; GAGGCATCCCATCCGGACATTGGAG
>probe:Drosophila_2:1641555_at:161:313; Interrogation_Position=249; Antisense; GCCAGCTCGCCGTTTAAAAATGTTC
>probe:Drosophila_2:1641555_at:405:179; Interrogation_Position=264; Antisense; AAAAATGTTCATTGGCGGCCTCAGT
>probe:Drosophila_2:1641555_at:495:3; Interrogation_Position=274; Antisense; ATTGGCGGCCTCAGTTGGCAGACAA
>probe:Drosophila_2:1641555_at:99:465; Interrogation_Position=311; Antisense; GTTGGCCCCATGGAGCTGGTAAATT
>probe:Drosophila_2:1641555_at:428:145; Interrogation_Position=378; Antisense; ACTCACATTGAGTCGCTGCAAGTGT
>probe:Drosophila_2:1641555_at:6:5; Interrogation_Position=496; Antisense; ATTGTTAGCCAAGTTGCAGCTCTGG
>probe:Drosophila_2:1641555_at:79:107; Interrogation_Position=554; Antisense; AGAACGACGGCTCAAGTGGCTTCCA
>probe:Drosophila_2:1641555_at:88:719; Interrogation_Position=580; Antisense; TTCCATTCGCGCCAAAAGCTTATGC
>probe:Drosophila_2:1641555_at:533:341; Interrogation_Position=603; Antisense; GCTTTGGATTTTTCGCAGCTATCGC
>probe:Drosophila_2:1641555_at:576:87; Interrogation_Position=641; Antisense; AGTCGCACAAACAGTCCAGGTCAAG
>probe:Drosophila_2:1641555_at:670:195; Interrogation_Position=74; Antisense; AACTGGAATTGCAAGTGCCGCAGCT

Paste this into a BLAST search page for me
ATCCTCCACTTGTTTTGGTCGGAATGAAGCTAGCTGAGGAGGCATCCCATGAGGCATCCCATCCGGACATTGGAGGCCAGCTCGCCGTTTAAAAATGTTCAAAAATGTTCATTGGCGGCCTCAGTATTGGCGGCCTCAGTTGGCAGACAAGTTGGCCCCATGGAGCTGGTAAATTACTCACATTGAGTCGCTGCAAGTGTATTGTTAGCCAAGTTGCAGCTCTGGAGAACGACGGCTCAAGTGGCTTCCATTCCATTCGCGCCAAAAGCTTATGCGCTTTGGATTTTTCGCAGCTATCGCAGTCGCACAAACAGTCCAGGTCAAGAACTGGAATTGCAAGTGCCGCAGCT

Full Affymetrix probeset data:

Annotations for 1641555_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720