FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641558_at:

>probe:Drosophila_2:1641558_at:618:719; Interrogation_Position=2644; Antisense; TTCCGACCGCACAAACTTGTAACTT
>probe:Drosophila_2:1641558_at:306:391; Interrogation_Position=2675; Antisense; GAAAGCCCGTAGTTTAGCTGGATTA
>probe:Drosophila_2:1641558_at:302:689; Interrogation_Position=2707; Antisense; TATTTTGAACCATTCGCGCATGAAA
>probe:Drosophila_2:1641558_at:213:229; Interrogation_Position=2784; Antisense; AATGCTGCCCAGTCTTAATTTTAAA
>probe:Drosophila_2:1641558_at:539:699; Interrogation_Position=2802; Antisense; TTTTAAATCTTTCTTCTCCGCCTCT
>probe:Drosophila_2:1641558_at:585:275; Interrogation_Position=2814; Antisense; CTTCTCCGCCTCTAATGCAATAGTA
>probe:Drosophila_2:1641558_at:336:713; Interrogation_Position=2862; Antisense; TTCGAACCGCAAACCCCAAATGTTG
>probe:Drosophila_2:1641558_at:53:131; Interrogation_Position=2941; Antisense; ACCTCAGTTAAGTTAGTCAGCGAAA
>probe:Drosophila_2:1641558_at:297:699; Interrogation_Position=2972; Antisense; TTTTTGTCCGTTTAGTTTTGATGCA
>probe:Drosophila_2:1641558_at:503:443; Interrogation_Position=2991; Antisense; GATGCAAATTCATTGGGCTCCTTTA
>probe:Drosophila_2:1641558_at:9:699; Interrogation_Position=3012; Antisense; TTTACAGCCTGCTCTACACTGAAAG
>probe:Drosophila_2:1641558_at:93:349; Interrogation_Position=3059; Antisense; GCAGAAATTTGCTGGCTAGTTAATC
>probe:Drosophila_2:1641558_at:253:249; Interrogation_Position=3083; Antisense; CAATACAATTGGGTGCTGACGACGA
>probe:Drosophila_2:1641558_at:324:335; Interrogation_Position=3097; Antisense; GCTGACGACGATATACCCACATATT

Paste this into a BLAST search page for me
TTCCGACCGCACAAACTTGTAACTTGAAAGCCCGTAGTTTAGCTGGATTATATTTTGAACCATTCGCGCATGAAAAATGCTGCCCAGTCTTAATTTTAAATTTTAAATCTTTCTTCTCCGCCTCTCTTCTCCGCCTCTAATGCAATAGTATTCGAACCGCAAACCCCAAATGTTGACCTCAGTTAAGTTAGTCAGCGAAATTTTTGTCCGTTTAGTTTTGATGCAGATGCAAATTCATTGGGCTCCTTTATTTACAGCCTGCTCTACACTGAAAGGCAGAAATTTGCTGGCTAGTTAATCCAATACAATTGGGTGCTGACGACGAGCTGACGACGATATACCCACATATT

Full Affymetrix probeset data:

Annotations for 1641558_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720