FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641559_at:

>probe:Drosophila_2:1641559_at:719:107; Interrogation_Position=295; Antisense; AGAACCCACGCGCTATGGCGACTGG
>probe:Drosophila_2:1641559_at:433:729; Interrogation_Position=368; Antisense; TTGGCCAATGCTCAACAGGCGCGAG
>probe:Drosophila_2:1641559_at:266:233; Interrogation_Position=421; Antisense; AATGCGATTTTCCAACGACTTAGTG
>probe:Drosophila_2:1641559_at:435:409; Interrogation_Position=453; Antisense; GACGATGGCCCAATGCATACGATCA
>probe:Drosophila_2:1641559_at:554:453; Interrogation_Position=473; Antisense; GATCATCAGTCTTGTCGGTACGAGA
>probe:Drosophila_2:1641559_at:718:671; Interrogation_Position=491; Antisense; TACGAGATCTCTCGATCACATCGAA
>probe:Drosophila_2:1641559_at:362:573; Interrogation_Position=550; Antisense; GGCTGTTTACGATCAGTTTCGCACC
>probe:Drosophila_2:1641559_at:713:693; Interrogation_Position=566; Antisense; TTTCGCACCCACTTGAGAGATTTCG
>probe:Drosophila_2:1641559_at:82:101; Interrogation_Position=581; Antisense; AGAGATTTCGCCTTTGCCGAATCAA
>probe:Drosophila_2:1641559_at:65:353; Interrogation_Position=627; Antisense; GCACCGACGGCAAATTGGAGGCTAT
>probe:Drosophila_2:1641559_at:488:137; Interrogation_Position=673; Antisense; ACGTTTTCAATCATCCATAGGTCGA
>probe:Drosophila_2:1641559_at:135:101; Interrogation_Position=742; Antisense; AGAGGGCGTCTTATCGGAGCGTATA
>probe:Drosophila_2:1641559_at:261:399; Interrogation_Position=779; Antisense; GACACTTTGACATTGCCAGTTTGGC
>probe:Drosophila_2:1641559_at:436:43; Interrogation_Position=851; Antisense; ATCGTTTATCACTTTCGTTCTCGTC

Paste this into a BLAST search page for me
AGAACCCACGCGCTATGGCGACTGGTTGGCCAATGCTCAACAGGCGCGAGAATGCGATTTTCCAACGACTTAGTGGACGATGGCCCAATGCATACGATCAGATCATCAGTCTTGTCGGTACGAGATACGAGATCTCTCGATCACATCGAAGGCTGTTTACGATCAGTTTCGCACCTTTCGCACCCACTTGAGAGATTTCGAGAGATTTCGCCTTTGCCGAATCAAGCACCGACGGCAAATTGGAGGCTATACGTTTTCAATCATCCATAGGTCGAAGAGGGCGTCTTATCGGAGCGTATAGACACTTTGACATTGCCAGTTTGGCATCGTTTATCACTTTCGTTCTCGTC

Full Affymetrix probeset data:

Annotations for 1641559_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720