Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641560_at:

>probe:Drosophila_2:1641560_at:667:211; Interrogation_Position=2174; Antisense; AAGACTCGGTTCCAAAGGCCATCAT
>probe:Drosophila_2:1641560_at:591:69; Interrogation_Position=2189; Antisense; AGGCCATCATGCATTTCTTGGTTAA
>probe:Drosophila_2:1641560_at:242:33; Interrogation_Position=2267; Antisense; ATAAGGCTGAAACCCTGCTCAACGA
>probe:Drosophila_2:1641560_at:453:619; Interrogation_Position=2282; Antisense; TGCTCAACGAGTCCGATCACATTGC
>probe:Drosophila_2:1641560_at:94:455; Interrogation_Position=2296; Antisense; GATCACATTGCAGTGCGCCGAAAAG
>probe:Drosophila_2:1641560_at:303:285; Interrogation_Position=2335; Antisense; CTGAAGGCACTGACGCGAGCGAATC
>probe:Drosophila_2:1641560_at:103:327; Interrogation_Position=2349; Antisense; GCGAGCGAATCACATCATCAGCGAA
>probe:Drosophila_2:1641560_at:610:163; Interrogation_Position=2372; Antisense; AAATCCGCGAGACCCACATGTGGTA
>probe:Drosophila_2:1641560_at:267:495; Interrogation_Position=2402; Antisense; GTCAGCGATTGGAGCAACCCGTTTC
>probe:Drosophila_2:1641560_at:228:475; Interrogation_Position=2422; Antisense; GTTTCGACTTAATAATCCCCGCATA
>probe:Drosophila_2:1641560_at:341:163; Interrogation_Position=2557; Antisense; AAATTCTGGGCCTTTCATTTAGCCA
>probe:Drosophila_2:1641560_at:355:707; Interrogation_Position=2575; Antisense; TTAGCCAACTCGCATTTCTATTCGC
>probe:Drosophila_2:1641560_at:254:691; Interrogation_Position=2593; Antisense; TATTCGCCTGGCATTTGTCTATCAT
>probe:Drosophila_2:1641560_at:141:415; Interrogation_Position=2619; Antisense; GAGCCTCTCCGCTTTTTAAATTAAT

Paste this into a BLAST search page for me
AAGACTCGGTTCCAAAGGCCATCATAGGCCATCATGCATTTCTTGGTTAAATAAGGCTGAAACCCTGCTCAACGATGCTCAACGAGTCCGATCACATTGCGATCACATTGCAGTGCGCCGAAAAGCTGAAGGCACTGACGCGAGCGAATCGCGAGCGAATCACATCATCAGCGAAAAATCCGCGAGACCCACATGTGGTAGTCAGCGATTGGAGCAACCCGTTTCGTTTCGACTTAATAATCCCCGCATAAAATTCTGGGCCTTTCATTTAGCCATTAGCCAACTCGCATTTCTATTCGCTATTCGCCTGGCATTTGTCTATCATGAGCCTCTCCGCTTTTTAAATTAAT

Full Affymetrix probeset data:

Annotations for 1641560_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime