Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641563_at:

>probe:Drosophila_2:1641563_at:306:329; Interrogation_Position=1648; Antisense; GCGTAGCGCCAGCAAACAGGAGATT
>probe:Drosophila_2:1641563_at:629:321; Interrogation_Position=1694; Antisense; GCGCAAAAGTGGCATCCGGACAACT
>probe:Drosophila_2:1641563_at:487:217; Interrogation_Position=1751; Antisense; AAGTTTATTGACATTGCCGCAGCCA
>probe:Drosophila_2:1641563_at:607:43; Interrogation_Position=1791; Antisense; ATCCCGAGAAGCGTCGTCAATTCGA
>probe:Drosophila_2:1641563_at:321:717; Interrogation_Position=1811; Antisense; TTCGACAACGGCGAGGATCCATTAG
>probe:Drosophila_2:1641563_at:101:449; Interrogation_Position=1826; Antisense; GATCCATTAGATCCTGAGAGCAATC
>probe:Drosophila_2:1641563_at:439:101; Interrogation_Position=1842; Antisense; AGAGCAATCAGCGTGGCGGCTTCCA
>probe:Drosophila_2:1641563_at:720:581; Interrogation_Position=1867; Antisense; TGGCGAACATCCGTTTGGACACTTC
>probe:Drosophila_2:1641563_at:654:155; Interrogation_Position=1894; Antisense; ACACGGGTCGCCGTTCCAGTTCAAG
>probe:Drosophila_2:1641563_at:114:469; Interrogation_Position=1918; Antisense; GTTCCACTTCAATTAGTCAGCCAGC
>probe:Drosophila_2:1641563_at:684:19; Interrogation_Position=1947; Antisense; ATTTGCTTTGTGATGTCCTAGCCGC
>probe:Drosophila_2:1641563_at:589:447; Interrogation_Position=1972; Antisense; GATCCCCGATATCCTTTAACGATTT
>probe:Drosophila_2:1641563_at:353:663; Interrogation_Position=2049; Antisense; TAAACCCATGGTCCGTTGTCAGAGA
>probe:Drosophila_2:1641563_at:117:181; Interrogation_Position=2101; Antisense; AAAACACACTGAGCACTTACATTTA

Paste this into a BLAST search page for me
GCGTAGCGCCAGCAAACAGGAGATTGCGCAAAAGTGGCATCCGGACAACTAAGTTTATTGACATTGCCGCAGCCAATCCCGAGAAGCGTCGTCAATTCGATTCGACAACGGCGAGGATCCATTAGGATCCATTAGATCCTGAGAGCAATCAGAGCAATCAGCGTGGCGGCTTCCATGGCGAACATCCGTTTGGACACTTCACACGGGTCGCCGTTCCAGTTCAAGGTTCCACTTCAATTAGTCAGCCAGCATTTGCTTTGTGATGTCCTAGCCGCGATCCCCGATATCCTTTAACGATTTTAAACCCATGGTCCGTTGTCAGAGAAAAACACACTGAGCACTTACATTTA

Full Affymetrix probeset data:

Annotations for 1641563_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime