FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641565_at:

>probe:Drosophila_2:1641565_at:603:241; Interrogation_Position=4410; Antisense; AATAGGCCTGATTCGAACTGCTGGA
>probe:Drosophila_2:1641565_at:216:421; Interrogation_Position=4432; Antisense; GGAAAATCCATTGTCCTAACCTCGC
>probe:Drosophila_2:1641565_at:149:499; Interrogation_Position=4444; Antisense; GTCCTAACCTCGCACAGTATGGATG
>probe:Drosophila_2:1641565_at:207:87; Interrogation_Position=4469; Antisense; AGTGCGAGGCTCTGTGCAGCCGATT
>probe:Drosophila_2:1641565_at:616:261; Interrogation_Position=4485; Antisense; CAGCCGATTGGCCATAATGGTCGAT
>probe:Drosophila_2:1641565_at:432:13; Interrogation_Position=4515; Antisense; ATTCAAGTGCTTGGGTTCGGTGCAA
>probe:Drosophila_2:1641565_at:210:649; Interrogation_Position=4551; Antisense; TCAGTTCTCAAAGGGCCTGATTCTT
>probe:Drosophila_2:1641565_at:328:387; Interrogation_Position=4599; Antisense; GAAAACTTTTCAGCGTGTTGTAGAA
>probe:Drosophila_2:1641565_at:400:95; Interrogation_Position=4623; Antisense; AGATTCTTCTTCCTCAAATGACAAA
>probe:Drosophila_2:1641565_at:610:91; Interrogation_Position=4673; Antisense; AGTTTCTTCAAATGGCTTCTGTTAT
>probe:Drosophila_2:1641565_at:650:213; Interrogation_Position=4748; Antisense; AAGAGATACCTGACGCAGAGCTCAA
>probe:Drosophila_2:1641565_at:455:651; Interrogation_Position=4836; Antisense; TCAACTCCTTGAAACTAACTCGCAT
>probe:Drosophila_2:1641565_at:169:187; Interrogation_Position=4893; Antisense; AACACGGCTGGAGGAAATCTTTTTG
>probe:Drosophila_2:1641565_at:700:707; Interrogation_Position=4952; Antisense; TTACTAAACGCATTTACTCCTGCTC

Paste this into a BLAST search page for me
AATAGGCCTGATTCGAACTGCTGGAGGAAAATCCATTGTCCTAACCTCGCGTCCTAACCTCGCACAGTATGGATGAGTGCGAGGCTCTGTGCAGCCGATTCAGCCGATTGGCCATAATGGTCGATATTCAAGTGCTTGGGTTCGGTGCAATCAGTTCTCAAAGGGCCTGATTCTTGAAAACTTTTCAGCGTGTTGTAGAAAGATTCTTCTTCCTCAAATGACAAAAGTTTCTTCAAATGGCTTCTGTTATAAGAGATACCTGACGCAGAGCTCAATCAACTCCTTGAAACTAACTCGCATAACACGGCTGGAGGAAATCTTTTTGTTACTAAACGCATTTACTCCTGCTC

Full Affymetrix probeset data:

Annotations for 1641565_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720