FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641567_at:

>probe:Drosophila_2:1641567_at:689:393; Interrogation_Position=29; Antisense; GAAATGCGTACCCTTATCCTTGTTA
>probe:Drosophila_2:1641567_at:312:533; Interrogation_Position=293; Antisense; GGTGGACCAGGAGGCCCCAAACCAT
>probe:Drosophila_2:1641567_at:411:175; Interrogation_Position=336; Antisense; AAACCACATCCACGACAACTGAGGC
>probe:Drosophila_2:1641567_at:616:195; Interrogation_Position=352; Antisense; AACTGAGGCCTCAACAAGCACTTCC
>probe:Drosophila_2:1641567_at:189:137; Interrogation_Position=380; Antisense; ACGACAGCTTCGTCCACTACAGTGT
>probe:Drosophila_2:1641567_at:439:667; Interrogation_Position=397; Antisense; TACAGTGTCCTCCACTACAGAGTCC
>probe:Drosophila_2:1641567_at:720:663; Interrogation_Position=412; Antisense; TACAGAGTCCTCTACGGAATCCTCG
>probe:Drosophila_2:1641567_at:667:367; Interrogation_Position=428; Antisense; GAATCCTCGACGGAATCATCCACAG
>probe:Drosophila_2:1641567_at:2:685; Interrogation_Position=43; Antisense; TATCCTTGTTACTCTTGTTGCCCTG
>probe:Drosophila_2:1641567_at:553:257; Interrogation_Position=448; Antisense; CACAGCATCCTCCACAGAATAAATC
>probe:Drosophila_2:1641567_at:596:29; Interrogation_Position=466; Antisense; ATAAATCGCTTGACATGTTCCCCTT
>probe:Drosophila_2:1641567_at:498:607; Interrogation_Position=476; Antisense; TGACATGTTCCCCTTCGAGTTTTGC
>probe:Drosophila_2:1641567_at:612:635; Interrogation_Position=490; Antisense; TCGAGTTTTGCCCATTCGGCTATTC
>probe:Drosophila_2:1641567_at:552:273; Interrogation_Position=502; Antisense; CATTCGGCTATTCCGGGTTCATAAA

Paste this into a BLAST search page for me
GAAATGCGTACCCTTATCCTTGTTAGGTGGACCAGGAGGCCCCAAACCATAAACCACATCCACGACAACTGAGGCAACTGAGGCCTCAACAAGCACTTCCACGACAGCTTCGTCCACTACAGTGTTACAGTGTCCTCCACTACAGAGTCCTACAGAGTCCTCTACGGAATCCTCGGAATCCTCGACGGAATCATCCACAGTATCCTTGTTACTCTTGTTGCCCTGCACAGCATCCTCCACAGAATAAATCATAAATCGCTTGACATGTTCCCCTTTGACATGTTCCCCTTCGAGTTTTGCTCGAGTTTTGCCCATTCGGCTATTCCATTCGGCTATTCCGGGTTCATAAA

Full Affymetrix probeset data:

Annotations for 1641567_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720