Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641568_a_at:

>probe:Drosophila_2:1641568_a_at:27:101; Interrogation_Position=479; Antisense; AGAGCTTTCCGACGACAACTTCGAG
>probe:Drosophila_2:1641568_a_at:551:517; Interrogation_Position=538; Antisense; GGGACTGGTTTATCTTCTTCTCTTC
>probe:Drosophila_2:1641568_a_at:158:369; Interrogation_Position=567; Antisense; GAATGTACCGTCTGTCAGCGACTCT
>probe:Drosophila_2:1641568_a_at:535:495; Interrogation_Position=580; Antisense; GTCAGCGACTCTATGCCGTTTGGGA
>probe:Drosophila_2:1641568_a_at:674:391; Interrogation_Position=628; Antisense; GAAAGCTGAATATTGCCCGCATGAA
>probe:Drosophila_2:1641568_a_at:411:431; Interrogation_Position=660; Antisense; GAGTCTGGAATCTCAACTGCTACGC
>probe:Drosophila_2:1641568_a_at:103:255; Interrogation_Position=673; Antisense; CAACTGCTACGCGACTGGGAGTATT
>probe:Drosophila_2:1641568_a_at:344:375; Interrogation_Position=699; Antisense; GAAGCACCGGCTTTTATTTTCTTGA
>probe:Drosophila_2:1641568_a_at:244:13; Interrogation_Position=745; Antisense; ATTCAGCCAAGCAATACAGTCCCGA
>probe:Drosophila_2:1641568_a_at:428:379; Interrogation_Position=768; Antisense; GAAGCCTTTGTCCAGTTTGCTGAGA
>probe:Drosophila_2:1641568_a_at:86:717; Interrogation_Position=855; Antisense; TTGGGCCCACTGCAAAGTTATTTTG
>probe:Drosophila_2:1641568_a_at:266:613; Interrogation_Position=884; Antisense; TGAAAACATAACATCGCTGGCGACT
>probe:Drosophila_2:1641568_a_at:597:277; Interrogation_Position=907; Antisense; CTTTGAGTATTTTCGCCTTAGTTGC
>probe:Drosophila_2:1641568_a_at:234:707; Interrogation_Position=924; Antisense; TTAGTTGCTCTCTTATTCGTTGGCA

Paste this into a BLAST search page for me
AGAGCTTTCCGACGACAACTTCGAGGGGACTGGTTTATCTTCTTCTCTTCGAATGTACCGTCTGTCAGCGACTCTGTCAGCGACTCTATGCCGTTTGGGAGAAAGCTGAATATTGCCCGCATGAAGAGTCTGGAATCTCAACTGCTACGCCAACTGCTACGCGACTGGGAGTATTGAAGCACCGGCTTTTATTTTCTTGAATTCAGCCAAGCAATACAGTCCCGAGAAGCCTTTGTCCAGTTTGCTGAGATTGGGCCCACTGCAAAGTTATTTTGTGAAAACATAACATCGCTGGCGACTCTTTGAGTATTTTCGCCTTAGTTGCTTAGTTGCTCTCTTATTCGTTGGCA

Full Affymetrix probeset data:

Annotations for 1641568_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime