FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641571_at:

>probe:Drosophila_2:1641571_at:412:681; Interrogation_Position=5359; Antisense; TATGTCTGCGAGATTGCCGACTGTT
>probe:Drosophila_2:1641571_at:191:9; Interrogation_Position=5371; Antisense; ATTGCCGACTGTTCAGCGAGCTTCA
>probe:Drosophila_2:1641571_at:642:417; Interrogation_Position=5388; Antisense; GAGCTTCAGTTCGAAGGCGGCACTG
>probe:Drosophila_2:1641571_at:140:31; Interrogation_Position=5428; Antisense; ATACACGCTTATGGTCGCAGTGCCA
>probe:Drosophila_2:1641571_at:444:339; Interrogation_Position=5567; Antisense; GCTACGCATGCGCAACACTAAGTGG
>probe:Drosophila_2:1641571_at:335:295; Interrogation_Position=5615; Antisense; CGAGTACCAATGTCGCTGGAGCAGT
>probe:Drosophila_2:1641571_at:389:359; Interrogation_Position=5654; Antisense; GCAACATGGCTCAAAACGGCAGCAA
>probe:Drosophila_2:1641571_at:692:111; Interrogation_Position=5674; Antisense; AGCAACTGCAGTGGCCATGCGAATG
>probe:Drosophila_2:1641571_at:645:241; Interrogation_Position=5703; Antisense; AATAGCAACATCTGCGCTTTCGACC
>probe:Drosophila_2:1641571_at:724:329; Interrogation_Position=5743; Antisense; GCGGGCATGGGCAATACCACTAACA
>probe:Drosophila_2:1641571_at:650:673; Interrogation_Position=5757; Antisense; TACCACTAACATACCGATTGCCAAG
>probe:Drosophila_2:1641571_at:88:251; Interrogation_Position=5778; Antisense; CAAGGAGGGCGAGTTCCCCTGCAAG
>probe:Drosophila_2:1641571_at:497:657; Interrogation_Position=5823; Antisense; TAAGGTGAAGAGTCGCAGTGCGCAC
>probe:Drosophila_2:1641571_at:586:73; Interrogation_Position=5867; Antisense; AGGAGCCGGATCAGAAACACCAACT

Paste this into a BLAST search page for me
TATGTCTGCGAGATTGCCGACTGTTATTGCCGACTGTTCAGCGAGCTTCAGAGCTTCAGTTCGAAGGCGGCACTGATACACGCTTATGGTCGCAGTGCCAGCTACGCATGCGCAACACTAAGTGGCGAGTACCAATGTCGCTGGAGCAGTGCAACATGGCTCAAAACGGCAGCAAAGCAACTGCAGTGGCCATGCGAATGAATAGCAACATCTGCGCTTTCGACCGCGGGCATGGGCAATACCACTAACATACCACTAACATACCGATTGCCAAGCAAGGAGGGCGAGTTCCCCTGCAAGTAAGGTGAAGAGTCGCAGTGCGCACAGGAGCCGGATCAGAAACACCAACT

Full Affymetrix probeset data:

Annotations for 1641571_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720