FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641573_at:

>probe:Drosophila_2:1641573_at:247:567; Interrogation_Position=1156; Antisense; GGCAGAAAATCTTCATTGTACAATT
>probe:Drosophila_2:1641573_at:363:241; Interrogation_Position=1177; Antisense; AATTAACCATGCTTATGTGCTGTGT
>probe:Drosophila_2:1641573_at:442:61; Interrogation_Position=1191; Antisense; ATGTGCTGTGTGTTCTTGTTTAAAA
>probe:Drosophila_2:1641573_at:313:187; Interrogation_Position=1215; Antisense; AACACTCTTGAAGTATCATATTGGA
>probe:Drosophila_2:1641573_at:580:31; Interrogation_Position=1245; Antisense; ATCAACGACAAAGCAACCTCATGTT
>probe:Drosophila_2:1641573_at:152:161; Interrogation_Position=1357; Antisense; AAATTAAACCTTTGCTGTACGGCTG
>probe:Drosophila_2:1641573_at:259:599; Interrogation_Position=1372; Antisense; TGTACGGCTGATGCGCCTAGGAACA
>probe:Drosophila_2:1641573_at:549:269; Interrogation_Position=1460; Antisense; CATGGTAACATATCATTGCTGGATT
>probe:Drosophila_2:1641573_at:13:715; Interrogation_Position=1475; Antisense; TTGCTGGATTATCTAGTGGCTTCGA
>probe:Drosophila_2:1641573_at:602:83; Interrogation_Position=1489; Antisense; AGTGGCTTCGATTTGCGAGCGTTCA
>probe:Drosophila_2:1641573_at:404:121; Interrogation_Position=1506; Antisense; AGCGTTCACTGTGCCGCCGGAAGAA
>probe:Drosophila_2:1641573_at:700:489; Interrogation_Position=1582; Antisense; GTACAGTACAGCGAACCAGCAAATA
>probe:Drosophila_2:1641573_at:456:163; Interrogation_Position=1602; Antisense; AAATAGAGGCACTCTCTTCGACCGA
>probe:Drosophila_2:1641573_at:697:643; Interrogation_Position=1616; Antisense; TCTTCGACCGACTGAGTGTGTTGGT

Paste this into a BLAST search page for me
GGCAGAAAATCTTCATTGTACAATTAATTAACCATGCTTATGTGCTGTGTATGTGCTGTGTGTTCTTGTTTAAAAAACACTCTTGAAGTATCATATTGGAATCAACGACAAAGCAACCTCATGTTAAATTAAACCTTTGCTGTACGGCTGTGTACGGCTGATGCGCCTAGGAACACATGGTAACATATCATTGCTGGATTTTGCTGGATTATCTAGTGGCTTCGAAGTGGCTTCGATTTGCGAGCGTTCAAGCGTTCACTGTGCCGCCGGAAGAAGTACAGTACAGCGAACCAGCAAATAAAATAGAGGCACTCTCTTCGACCGATCTTCGACCGACTGAGTGTGTTGGT

Full Affymetrix probeset data:

Annotations for 1641573_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720