FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641575_at:

>probe:Drosophila_2:1641575_at:508:399; Interrogation_Position=6094; Antisense; GACACGTACCGTACATAGCACATAT
>probe:Drosophila_2:1641575_at:62:141; Interrogation_Position=6147; Antisense; ACTGGTAAGCCAGCGTTTATCTAGA
>probe:Drosophila_2:1641575_at:719:371; Interrogation_Position=6231; Antisense; GAAATTCTCCCGCATAATTAATGAC
>probe:Drosophila_2:1641575_at:730:5; Interrogation_Position=6280; Antisense; ATTGACAATGTCTAGCCGTAATGAA
>probe:Drosophila_2:1641575_at:164:491; Interrogation_Position=6333; Antisense; GTACATCTACAATGGCATCTACACA
>probe:Drosophila_2:1641575_at:85:37; Interrogation_Position=6349; Antisense; ATCTACACAATGCAGTCTTTACTCG
>probe:Drosophila_2:1641575_at:498:477; Interrogation_Position=6363; Antisense; GTCTTTACTCGAAAACTTCCGCGAT
>probe:Drosophila_2:1641575_at:152:275; Interrogation_Position=6378; Antisense; CTTCCGCGATATTAGTTTTAATGGC
>probe:Drosophila_2:1641575_at:114:583; Interrogation_Position=6399; Antisense; TGGCGATCCAAATCGTCTACAGCTT
>probe:Drosophila_2:1641575_at:206:499; Interrogation_Position=6413; Antisense; GTCTACAGCTTAAGTTGTACCACTA
>probe:Drosophila_2:1641575_at:490:687; Interrogation_Position=6450; Antisense; TATTTGCTCTTCCAATTCCGTAACA
>probe:Drosophila_2:1641575_at:132:705; Interrogation_Position=6520; Antisense; TTAGCCAAACTTGCTCATACTTATA
>probe:Drosophila_2:1641575_at:144:657; Interrogation_Position=6589; Antisense; TAAGTTACTTTTGACCGCTGTCCGA
>probe:Drosophila_2:1641575_at:448:291; Interrogation_Position=6621; Antisense; CGGGCAGAGCCAGAAACTCATTTAT

Paste this into a BLAST search page for me
GACACGTACCGTACATAGCACATATACTGGTAAGCCAGCGTTTATCTAGAGAAATTCTCCCGCATAATTAATGACATTGACAATGTCTAGCCGTAATGAAGTACATCTACAATGGCATCTACACAATCTACACAATGCAGTCTTTACTCGGTCTTTACTCGAAAACTTCCGCGATCTTCCGCGATATTAGTTTTAATGGCTGGCGATCCAAATCGTCTACAGCTTGTCTACAGCTTAAGTTGTACCACTATATTTGCTCTTCCAATTCCGTAACATTAGCCAAACTTGCTCATACTTATATAAGTTACTTTTGACCGCTGTCCGACGGGCAGAGCCAGAAACTCATTTAT

Full Affymetrix probeset data:

Annotations for 1641575_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720