Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641576_a_at:

>probe:Drosophila_2:1641576_a_at:511:537; Interrogation_Position=117; Antisense; GGTAGTGAGTTCCTAACGTTGCCAG
>probe:Drosophila_2:1641576_a_at:413:559; Interrogation_Position=152; Antisense; GGACAATCTCGATGCCTTTTTGAAC
>probe:Drosophila_2:1641576_a_at:249:681; Interrogation_Position=192; Antisense; TATGACTACTTAACACTACCCGTGC
>probe:Drosophila_2:1641576_a_at:219:279; Interrogation_Position=207; Antisense; CTACCCGTGCTGAAGGAGCTGTGCA
>probe:Drosophila_2:1641576_a_at:77:205; Interrogation_Position=255; Antisense; AAGCCACTGCGAGATGCCTTCGAGG
>probe:Drosophila_2:1641576_a_at:385:79; Interrogation_Position=365; Antisense; AGGTAATCCAAGACTTGCCCGAGAT
>probe:Drosophila_2:1641576_a_at:253:231; Interrogation_Position=427; Antisense; AATGAGTATGCCAAGCGACCGCTCT
>probe:Drosophila_2:1641576_a_at:198:299; Interrogation_Position=446; Antisense; CGCTCTCACTTTCTGATGACACGAG
>probe:Drosophila_2:1641576_a_at:54:325; Interrogation_Position=473; Antisense; GCGAATGGATGTCCCTGCATGCCAA
>probe:Drosophila_2:1641576_a_at:687:605; Interrogation_Position=488; Antisense; TGCATGCCAATGAGGACTACGTTCT
>probe:Drosophila_2:1641576_a_at:519:723; Interrogation_Position=523; Antisense; TTGCAGCGGCTTAATGTCAGTGGAC
>probe:Drosophila_2:1641576_a_at:446:367; Interrogation_Position=606; Antisense; GAATGAAGCGTGGTTCCTGACCCTG
>probe:Drosophila_2:1641576_a_at:385:419; Interrogation_Position=649; Antisense; GAGCTCCTCGCCATGAAGCGTGTAT
>probe:Drosophila_2:1641576_a_at:276:379; Interrogation_Position=663; Antisense; GAAGCGTGTATCCATTCGCGGACAG

Paste this into a BLAST search page for me
GGTAGTGAGTTCCTAACGTTGCCAGGGACAATCTCGATGCCTTTTTGAACTATGACTACTTAACACTACCCGTGCCTACCCGTGCTGAAGGAGCTGTGCAAAGCCACTGCGAGATGCCTTCGAGGAGGTAATCCAAGACTTGCCCGAGATAATGAGTATGCCAAGCGACCGCTCTCGCTCTCACTTTCTGATGACACGAGGCGAATGGATGTCCCTGCATGCCAATGCATGCCAATGAGGACTACGTTCTTTGCAGCGGCTTAATGTCAGTGGACGAATGAAGCGTGGTTCCTGACCCTGGAGCTCCTCGCCATGAAGCGTGTATGAAGCGTGTATCCATTCGCGGACAG

Full Affymetrix probeset data:

Annotations for 1641576_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime