FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641577_at:

>probe:Drosophila_2:1641577_at:347:203; Interrogation_Position=1014; Antisense; AACCACATCCGCGTTTTATAGATTG
>probe:Drosophila_2:1641577_at:463:723; Interrogation_Position=1036; Antisense; TTGAGCCTGGCTAAGATATCCGAGT
>probe:Drosophila_2:1641577_at:396:45; Interrogation_Position=1074; Antisense; ATCGCGTGTGTTTTTGTGGCCTTAC
>probe:Drosophila_2:1641577_at:428:495; Interrogation_Position=1165; Antisense; GTCAAAATCGTATTTGCCCTGCCGC
>probe:Drosophila_2:1641577_at:671:305; Interrogation_Position=1182; Antisense; CCTGCCGCAGGTGAGTTGTGTTGAA
>probe:Drosophila_2:1641577_at:399:417; Interrogation_Position=1210; Antisense; GAGCTTAAGTCGAACCGTTTGCTTC
>probe:Drosophila_2:1641577_at:508:345; Interrogation_Position=1255; Antisense; GCATTTTATGTGCAACTGCCGCCCA
>probe:Drosophila_2:1641577_at:627:325; Interrogation_Position=712; Antisense; GCGACTCCTGCAACACTTGTTTATG
>probe:Drosophila_2:1641577_at:2:61; Interrogation_Position=734; Antisense; ATGTTAATGCCGTTCGGTGGTCCAT
>probe:Drosophila_2:1641577_at:236:621; Interrogation_Position=821; Antisense; TGCTGGACTGTATTACTCGCACCAC
>probe:Drosophila_2:1641577_at:269:127; Interrogation_Position=841; Antisense; ACCACTTCAATCAAATCGCTTCGCT
>probe:Drosophila_2:1641577_at:46:397; Interrogation_Position=878; Antisense; GACAATTGCCAAGTGTGCCGCTTAA
>probe:Drosophila_2:1641577_at:319:167; Interrogation_Position=910; Antisense; AAATGCATTTCACCAACACAGCCTG
>probe:Drosophila_2:1641577_at:372:689; Interrogation_Position=988; Antisense; TATTTCACTTGCCAGTTTTTGCTGC

Paste this into a BLAST search page for me
AACCACATCCGCGTTTTATAGATTGTTGAGCCTGGCTAAGATATCCGAGTATCGCGTGTGTTTTTGTGGCCTTACGTCAAAATCGTATTTGCCCTGCCGCCCTGCCGCAGGTGAGTTGTGTTGAAGAGCTTAAGTCGAACCGTTTGCTTCGCATTTTATGTGCAACTGCCGCCCAGCGACTCCTGCAACACTTGTTTATGATGTTAATGCCGTTCGGTGGTCCATTGCTGGACTGTATTACTCGCACCACACCACTTCAATCAAATCGCTTCGCTGACAATTGCCAAGTGTGCCGCTTAAAAATGCATTTCACCAACACAGCCTGTATTTCACTTGCCAGTTTTTGCTGC

Full Affymetrix probeset data:

Annotations for 1641577_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720