Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641578_at:

>probe:Drosophila_2:1641578_at:196:175; Interrogation_Position=2349; Antisense; AAACCTGCAACGAAGGAGGGCACTC
>probe:Drosophila_2:1641578_at:468:549; Interrogation_Position=2363; Antisense; GGAGGGCACTCCACTATGTAATATA
>probe:Drosophila_2:1641578_at:127:653; Interrogation_Position=2399; Antisense; TACTCGTAAACTAACCCGCATAAAT
>probe:Drosophila_2:1641578_at:272:661; Interrogation_Position=2473; Antisense; TAAACGGAAATTACGCGGAGCAACG
>probe:Drosophila_2:1641578_at:178:553; Interrogation_Position=2489; Antisense; GGAGCAACGCAGCAAACGTCAAAGA
>probe:Drosophila_2:1641578_at:365:115; Interrogation_Position=2513; Antisense; AGCAGGATGTGCCAAATGTTCAGAT
>probe:Drosophila_2:1641578_at:284:391; Interrogation_Position=2597; Antisense; GAAACTGTGGCAACTCTGGCAGCTA
>probe:Drosophila_2:1641578_at:583:193; Interrogation_Position=2608; Antisense; AACTCTGGCAGCTATTTTAGTGCAA
>probe:Drosophila_2:1641578_at:393:679; Interrogation_Position=2625; Antisense; TAGTGCAATTTTTGTGACGCCTTCA
>probe:Drosophila_2:1641578_at:660:309; Interrogation_Position=2653; Antisense; CCACTTCTCCGGAATTTGAGCAAGT
>probe:Drosophila_2:1641578_at:292:395; Interrogation_Position=2696; Antisense; GAAATTGCGCAAAGGCTTTTAACTA
>probe:Drosophila_2:1641578_at:204:137; Interrogation_Position=2722; Antisense; ACGTATAGTAACCACCATGACTCCT
>probe:Drosophila_2:1641578_at:198:283; Interrogation_Position=2745; Antisense; CTCCTCTTCCCACTAAATTATGCAT
>probe:Drosophila_2:1641578_at:77:689; Interrogation_Position=2825; Antisense; TTGGCGATGTTTCGGTTTAAACACT

Paste this into a BLAST search page for me
AAACCTGCAACGAAGGAGGGCACTCGGAGGGCACTCCACTATGTAATATATACTCGTAAACTAACCCGCATAAATTAAACGGAAATTACGCGGAGCAACGGGAGCAACGCAGCAAACGTCAAAGAAGCAGGATGTGCCAAATGTTCAGATGAAACTGTGGCAACTCTGGCAGCTAAACTCTGGCAGCTATTTTAGTGCAATAGTGCAATTTTTGTGACGCCTTCACCACTTCTCCGGAATTTGAGCAAGTGAAATTGCGCAAAGGCTTTTAACTAACGTATAGTAACCACCATGACTCCTCTCCTCTTCCCACTAAATTATGCATTTGGCGATGTTTCGGTTTAAACACT

Full Affymetrix probeset data:

Annotations for 1641578_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime