FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641579_at:

>probe:Drosophila_2:1641579_at:486:123; Interrogation_Position=266; Antisense; AGCGCACGGAGCTCATGAGGCTACA
>probe:Drosophila_2:1641579_at:72:491; Interrogation_Position=297; Antisense; GTACAAAACGCAGCTTCGCTCAGTG
>probe:Drosophila_2:1641579_at:700:633; Interrogation_Position=312; Antisense; TCGCTCAGTGCGTCAGTTTCTAAGG
>probe:Drosophila_2:1641579_at:510:657; Interrogation_Position=332; Antisense; TAAGGGAGGAAGTCGTCCGCCACGA
>probe:Drosophila_2:1641579_at:719:175; Interrogation_Position=359; Antisense; AAACATCCACAGCAGATCACATCGT
>probe:Drosophila_2:1641579_at:728:165; Interrogation_Position=418; Antisense; AAATGCCTGGATGCCAATGCTGCCT
>probe:Drosophila_2:1641579_at:314:233; Interrogation_Position=433; Antisense; AATGCTGCCTGGAACGCTGCCATAG
>probe:Drosophila_2:1641579_at:473:75; Interrogation_Position=461; Antisense; AGGAGCGTGATCAGCGATTGGCCAA
>probe:Drosophila_2:1641579_at:370:129; Interrogation_Position=569; Antisense; ACCAGCGGGTGCTGCTCGAGATTGA
>probe:Drosophila_2:1641579_at:525:727; Interrogation_Position=625; Antisense; TTGGATGCAGCCATTGAGACAGCGT
>probe:Drosophila_2:1641579_at:711:607; Interrogation_Position=639; Antisense; TGAGACAGCGTTGGCCAATCCCGTG
>probe:Drosophila_2:1641579_at:449:587; Interrogation_Position=662; Antisense; TGGACCACAATTTCGCCATCGATAT
>probe:Drosophila_2:1641579_at:590:473; Interrogation_Position=691; Antisense; GGTAATCTTTACCACGGACGAAGCA
>probe:Drosophila_2:1641579_at:642:377; Interrogation_Position=742; Antisense; GAACCCAACCAGCAAGTTTTGAGTA

Paste this into a BLAST search page for me
AGCGCACGGAGCTCATGAGGCTACAGTACAAAACGCAGCTTCGCTCAGTGTCGCTCAGTGCGTCAGTTTCTAAGGTAAGGGAGGAAGTCGTCCGCCACGAAAACATCCACAGCAGATCACATCGTAAATGCCTGGATGCCAATGCTGCCTAATGCTGCCTGGAACGCTGCCATAGAGGAGCGTGATCAGCGATTGGCCAAACCAGCGGGTGCTGCTCGAGATTGATTGGATGCAGCCATTGAGACAGCGTTGAGACAGCGTTGGCCAATCCCGTGTGGACCACAATTTCGCCATCGATATGGTAATCTTTACCACGGACGAAGCAGAACCCAACCAGCAAGTTTTGAGTA

Full Affymetrix probeset data:

Annotations for 1641579_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720