FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641580_at:

>probe:Drosophila_2:1641580_at:565:307; Interrogation_Position=1036; Antisense; GCCAAGGTTTCCAGGCAGACGAACA
>probe:Drosophila_2:1641580_at:416:661; Interrogation_Position=1061; Antisense; TAAACCTGGAGAACCGACTGTCCCG
>probe:Drosophila_2:1641580_at:191:599; Interrogation_Position=1079; Antisense; TGTCCCGCGTCCAGGAGGATGCAGA
>probe:Drosophila_2:1641580_at:689:73; Interrogation_Position=1115; Antisense; AGGAACTCAAGCTGCTGCGCGAGGA
>probe:Drosophila_2:1641580_at:537:663; Interrogation_Position=1175; Antisense; TAAAGCTGCGGGACAGCCGGATCCG
>probe:Drosophila_2:1641580_at:456:543; Interrogation_Position=1193; Antisense; GGATCCGGGCTCTTAAACGCCAGCG
>probe:Drosophila_2:1641580_at:18:327; Interrogation_Position=1220; Antisense; GCGACCTGCTCAACGCGTACAAGAA
>probe:Drosophila_2:1641580_at:417:379; Interrogation_Position=1269; Antisense; GAAGCGCCAGACCATCTGTTTGGAG
>probe:Drosophila_2:1641580_at:98:41; Interrogation_Position=1282; Antisense; ATCTGTTTGGAGCAGTCGGCAGCCA
>probe:Drosophila_2:1641580_at:590:287; Interrogation_Position=1344; Antisense; CTGGAATGCCAAGACGTGAGCCCTC
>probe:Drosophila_2:1641580_at:221:513; Interrogation_Position=1359; Antisense; GTGAGCCCTCCTGCATTATGAAATC
>probe:Drosophila_2:1641580_at:229:709; Interrogation_Position=1431; Antisense; TTACATTTTATGGTCTCACTCGAAA
>probe:Drosophila_2:1641580_at:342:253; Interrogation_Position=928; Antisense; CAACTGATGCGGTCCGAACGGCAGT
>probe:Drosophila_2:1641580_at:713:195; Interrogation_Position=944; Antisense; AACGGCAGTGCGAGGGTTTCAACCA

Paste this into a BLAST search page for me
GCCAAGGTTTCCAGGCAGACGAACATAAACCTGGAGAACCGACTGTCCCGTGTCCCGCGTCCAGGAGGATGCAGAAGGAACTCAAGCTGCTGCGCGAGGATAAAGCTGCGGGACAGCCGGATCCGGGATCCGGGCTCTTAAACGCCAGCGGCGACCTGCTCAACGCGTACAAGAAGAAGCGCCAGACCATCTGTTTGGAGATCTGTTTGGAGCAGTCGGCAGCCACTGGAATGCCAAGACGTGAGCCCTCGTGAGCCCTCCTGCATTATGAAATCTTACATTTTATGGTCTCACTCGAAACAACTGATGCGGTCCGAACGGCAGTAACGGCAGTGCGAGGGTTTCAACCA

Full Affymetrix probeset data:

Annotations for 1641580_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720