Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641581_at:

>probe:Drosophila_2:1641581_at:74:305; Interrogation_Position=278; Antisense; CCGGCGAGCCTGGTGCAGCAACTGA
>probe:Drosophila_2:1641581_at:725:505; Interrogation_Position=290; Antisense; GTGCAGCAACTGAGCCCGGCGTCGA
>probe:Drosophila_2:1641581_at:609:261; Interrogation_Position=362; Antisense; CACCATTCGAGTACTCCATCGATTT
>probe:Drosophila_2:1641581_at:429:621; Interrogation_Position=399; Antisense; TGCTGAGGTGCCGTACGTTAGGAAC
>probe:Drosophila_2:1641581_at:464:249; Interrogation_Position=408; Antisense; GCCGTACGTTAGGAACGCGGAGCCA
>probe:Drosophila_2:1641581_at:540:379; Interrogation_Position=420; Antisense; GAACGCGGAGCCAGGAGACTTTGCT
>probe:Drosophila_2:1641581_at:604:415; Interrogation_Position=427; Antisense; GAGCCAGGAGACTTTGCTCCGCCCG
>probe:Drosophila_2:1641581_at:689:125; Interrogation_Position=483; Antisense; AGCCGAGGGAGCACCAGCAGCGGAA
>probe:Drosophila_2:1641581_at:655:617; Interrogation_Position=537; Antisense; TGCAGAGGGCGCTCCACCGGCAGAA
>probe:Drosophila_2:1641581_at:302:113; Interrogation_Position=570; Antisense; AGCACCTGCACCTGCTGAGGGTGAA
>probe:Drosophila_2:1641581_at:300:131; Interrogation_Position=579; Antisense; ACCTGCTGAGGGTGAAGCTGCTCCA
>probe:Drosophila_2:1641581_at:346:133; Interrogation_Position=648; Antisense; ACCGCCGGCTGAGGGAGAGGCTGCT
>probe:Drosophila_2:1641581_at:157:621; Interrogation_Position=669; Antisense; TGCTCCGGCACCAGCCGAGGGCGAA
>probe:Drosophila_2:1641581_at:519:251; Interrogation_Position=684; Antisense; CGAGGGCGAAGCACCACCTGCCGAG

Paste this into a BLAST search page for me
CCGGCGAGCCTGGTGCAGCAACTGAGTGCAGCAACTGAGCCCGGCGTCGACACCATTCGAGTACTCCATCGATTTTGCTGAGGTGCCGTACGTTAGGAACGCCGTACGTTAGGAACGCGGAGCCAGAACGCGGAGCCAGGAGACTTTGCTGAGCCAGGAGACTTTGCTCCGCCCGAGCCGAGGGAGCACCAGCAGCGGAATGCAGAGGGCGCTCCACCGGCAGAAAGCACCTGCACCTGCTGAGGGTGAAACCTGCTGAGGGTGAAGCTGCTCCAACCGCCGGCTGAGGGAGAGGCTGCTTGCTCCGGCACCAGCCGAGGGCGAACGAGGGCGAAGCACCACCTGCCGAG

Full Affymetrix probeset data:

Annotations for 1641581_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime