Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641582_at:

>probe:Drosophila_2:1641582_at:493:73; Interrogation_Position=1456; Antisense; AGGACGGTGTCCTTCTTCGGATGGA
>probe:Drosophila_2:1641582_at:702:589; Interrogation_Position=1477; Antisense; TGGATTGCCTTCATCACCATGAGAA
>probe:Drosophila_2:1641582_at:198:607; Interrogation_Position=1496; Antisense; TGAGAATGCTTTCGTTGTCCACTTT
>probe:Drosophila_2:1641582_at:162:259; Interrogation_Position=1515; Antisense; CACTTTCTGTGTCTTCTATCCGAAG
>probe:Drosophila_2:1641582_at:200:7; Interrogation_Position=1542; Antisense; ATTCTTTATCCTGGTGGGCGTACAC
>probe:Drosophila_2:1641582_at:480:489; Interrogation_Position=1561; Antisense; GTACACTATGCGCTGATGCTGGGTT
>probe:Drosophila_2:1641582_at:556:719; Interrogation_Position=1584; Antisense; TTGCCTGGCATTGGAAACCCGTTGT
>probe:Drosophila_2:1641582_at:570:589; Interrogation_Position=1611; Antisense; TGGTAGTTGGAGTCGCAGCCTGTTC
>probe:Drosophila_2:1641582_at:324:245; Interrogation_Position=1676; Antisense; AATTCCGCGTGTCCTTCAAGAACAT
>probe:Drosophila_2:1641582_at:329:681; Interrogation_Position=1711; Antisense; TATGGTGGATACCTGGTGCTCACGC
>probe:Drosophila_2:1641582_at:226:135; Interrogation_Position=1732; Antisense; ACGCTCGTCGAGAACATTACCATAT
>probe:Drosophila_2:1641582_at:447:429; Interrogation_Position=1786; Antisense; GAGTCCTGGTGGTTCGGTTTCATCT
>probe:Drosophila_2:1641582_at:269:697; Interrogation_Position=1859; Antisense; TTTACTACTGTATACTCCGACCCAA
>probe:Drosophila_2:1641582_at:665:349; Interrogation_Position=1962; Antisense; GCAGTTTCCGGCTAGTTTGTTATAT

Paste this into a BLAST search page for me
AGGACGGTGTCCTTCTTCGGATGGATGGATTGCCTTCATCACCATGAGAATGAGAATGCTTTCGTTGTCCACTTTCACTTTCTGTGTCTTCTATCCGAAGATTCTTTATCCTGGTGGGCGTACACGTACACTATGCGCTGATGCTGGGTTTTGCCTGGCATTGGAAACCCGTTGTTGGTAGTTGGAGTCGCAGCCTGTTCAATTCCGCGTGTCCTTCAAGAACATTATGGTGGATACCTGGTGCTCACGCACGCTCGTCGAGAACATTACCATATGAGTCCTGGTGGTTCGGTTTCATCTTTTACTACTGTATACTCCGACCCAAGCAGTTTCCGGCTAGTTTGTTATAT

Full Affymetrix probeset data:

Annotations for 1641582_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime