FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641583_at:

>probe:Drosophila_2:1641583_at:423:5; Interrogation_Position=1012; Antisense; ATTGTGGCCACGCAAATGACATCGA
>probe:Drosophila_2:1641583_at:718:505; Interrogation_Position=1048; Antisense; GTGCCAGGCATTCGTTATGTGATCA
>probe:Drosophila_2:1641583_at:455:455; Interrogation_Position=1068; Antisense; GATCAATTATGATTTCCCGGACAAC
>probe:Drosophila_2:1641583_at:408:527; Interrogation_Position=1125; Antisense; GGGATGCCTGTCGTATAACCGTAAC
>probe:Drosophila_2:1641583_at:226:493; Interrogation_Position=1145; Antisense; GTAACTGCGAGGTCATCAGCTTCTT
>probe:Drosophila_2:1641583_at:533:35; Interrogation_Position=1159; Antisense; ATCAGCTTCTTTACCATGGCAAACT
>probe:Drosophila_2:1641583_at:656:565; Interrogation_Position=1176; Antisense; GGCAAACTACAAGCTCGTGACGGAA
>probe:Drosophila_2:1641583_at:293:397; Interrogation_Position=1231; Antisense; GAAATTGGACCGCATCTTCTTCAGC
>probe:Drosophila_2:1641583_at:607:461; Interrogation_Position=752; Antisense; GATTACAAAACATCCGCCAGCGGGT
>probe:Drosophila_2:1641583_at:4:419; Interrogation_Position=820; Antisense; GAGCTGACTGCTATTTACGATACAA
>probe:Drosophila_2:1641583_at:527:445; Interrogation_Position=912; Antisense; GATCCGGAATTGTGTACCCTGCGAG
>probe:Drosophila_2:1641583_at:89:65; Interrogation_Position=944; Antisense; ATGGTGGACGCACTGCCCAAGAAAA
>probe:Drosophila_2:1641583_at:569:233; Interrogation_Position=978; Antisense; AATCCATGATTTTGGCACTGGCGCC
>probe:Drosophila_2:1641583_at:539:355; Interrogation_Position=992; Antisense; GCACTGGCGCCTACAATATCATTGT

Paste this into a BLAST search page for me
ATTGTGGCCACGCAAATGACATCGAGTGCCAGGCATTCGTTATGTGATCAGATCAATTATGATTTCCCGGACAACGGGATGCCTGTCGTATAACCGTAACGTAACTGCGAGGTCATCAGCTTCTTATCAGCTTCTTTACCATGGCAAACTGGCAAACTACAAGCTCGTGACGGAAGAAATTGGACCGCATCTTCTTCAGCGATTACAAAACATCCGCCAGCGGGTGAGCTGACTGCTATTTACGATACAAGATCCGGAATTGTGTACCCTGCGAGATGGTGGACGCACTGCCCAAGAAAAAATCCATGATTTTGGCACTGGCGCCGCACTGGCGCCTACAATATCATTGT

Full Affymetrix probeset data:

Annotations for 1641583_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720