FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641584_at:

>probe:Drosophila_2:1641584_at:331:273; Interrogation_Position=1002; Antisense; CATTCTCCTACTCTAACGTGCTAAA
>probe:Drosophila_2:1641584_at:494:107; Interrogation_Position=1053; Antisense; AGAAGCCTTTTCTCTGTCGAGTCTG
>probe:Drosophila_2:1641584_at:675:611; Interrogation_Position=1076; Antisense; TGCAATAAGACCTTTTCCCGCAAGC
>probe:Drosophila_2:1641584_at:474:729; Interrogation_Position=1106; Antisense; TTGGATCAGCATTTGGGCACCATGA
>probe:Drosophila_2:1641584_at:604:373; Interrogation_Position=707; Antisense; GAAGTATCCTCCACGAACATTATGT
>probe:Drosophila_2:1641584_at:486:237; Interrogation_Position=736; Antisense; AATCTGCGGCAATATCTACTCCAAG
>probe:Drosophila_2:1641584_at:526:337; Interrogation_Position=767; Antisense; GCTCTCAACATTCATATGCGTCGTC
>probe:Drosophila_2:1641584_at:532:49; Interrogation_Position=782; Antisense; ATGCGTCGTCATATGGCCGAGAAAC
>probe:Drosophila_2:1641584_at:144:243; Interrogation_Position=820; Antisense; AATATGCAGCAAATCCTTCGCGGGT
>probe:Drosophila_2:1641584_at:40:537; Interrogation_Position=842; Antisense; GGTCCATCCGAGCTAAATCGCCATA
>probe:Drosophila_2:1641584_at:516:681; Interrogation_Position=865; Antisense; TATCCGCGTTCACACGGGCGAGAAA
>probe:Drosophila_2:1641584_at:691:513; Interrogation_Position=898; Antisense; GTGTAAATATTGCAACCGCTCGTTT
>probe:Drosophila_2:1641584_at:144:45; Interrogation_Position=927; Antisense; ATCGCAGCTCCAATATTCGTCATGA
>probe:Drosophila_2:1641584_at:277:107; Interrogation_Position=953; Antisense; AGAACACACACAAACGAGCGACCTT

Paste this into a BLAST search page for me
CATTCTCCTACTCTAACGTGCTAAAAGAAGCCTTTTCTCTGTCGAGTCTGTGCAATAAGACCTTTTCCCGCAAGCTTGGATCAGCATTTGGGCACCATGAGAAGTATCCTCCACGAACATTATGTAATCTGCGGCAATATCTACTCCAAGGCTCTCAACATTCATATGCGTCGTCATGCGTCGTCATATGGCCGAGAAACAATATGCAGCAAATCCTTCGCGGGTGGTCCATCCGAGCTAAATCGCCATATATCCGCGTTCACACGGGCGAGAAAGTGTAAATATTGCAACCGCTCGTTTATCGCAGCTCCAATATTCGTCATGAAGAACACACACAAACGAGCGACCTT

Full Affymetrix probeset data:

Annotations for 1641584_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720