FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1641585_at:

>probe:Drosophila_2:1641585_at:710:471; Interrogation_Position=297; Antisense; GTTCATCAGCATCGGTGAGTCAACG
>probe:Drosophila_2:1641585_at:487:41; Interrogation_Position=307; Antisense; ATCGGTGAGTCAACGAACCCTCGAA
>probe:Drosophila_2:1641585_at:119:513; Interrogation_Position=311; Antisense; GTGAGTCAACGAACCCTCGAACAAT
>probe:Drosophila_2:1641585_at:65:491; Interrogation_Position=315; Antisense; GTCAACGAACCCTCGAACAATGGGA
>probe:Drosophila_2:1641585_at:154:387; Interrogation_Position=329; Antisense; GAACAATGGGACAACATGCCGTCTT
>probe:Drosophila_2:1641585_at:591:397; Interrogation_Position=338; Antisense; GACAACATGCCGTCTTTATGCACAG
>probe:Drosophila_2:1641585_at:697:269; Interrogation_Position=343; Antisense; CATGCCGTCTTTATGCACAGGAAAA
>probe:Drosophila_2:1641585_at:190:175; Interrogation_Position=389; Antisense; AAACCAATCCAAATGAATGCTCATG
>probe:Drosophila_2:1641585_at:88:51; Interrogation_Position=405; Antisense; ATGCTCATGCAAACAAGATTGTGTC
>probe:Drosophila_2:1641585_at:623:465; Interrogation_Position=421; Antisense; GATTGTGTCCAGTTGGAATCAACAA
>probe:Drosophila_2:1641585_at:212:565; Interrogation_Position=435; Antisense; GGAATCAACAATACTTAAATGCTAC
>probe:Drosophila_2:1641585_at:472:227; Interrogation_Position=452; Antisense; AATGCTACTATGCTAACTTATTTAA
>probe:Drosophila_2:1641585_at:124:689; Interrogation_Position=470; Antisense; TATTTAAATTATGTGGCCGTGTTCC
>probe:Drosophila_2:1641585_at:484:13; Interrogation_Position=477; Antisense; ATTATGTGGCCGTGTTCCAGGGCGC

Paste this into a BLAST search page for me
GTTCATCAGCATCGGTGAGTCAACGATCGGTGAGTCAACGAACCCTCGAAGTGAGTCAACGAACCCTCGAACAATGTCAACGAACCCTCGAACAATGGGAGAACAATGGGACAACATGCCGTCTTGACAACATGCCGTCTTTATGCACAGCATGCCGTCTTTATGCACAGGAAAAAAACCAATCCAAATGAATGCTCATGATGCTCATGCAAACAAGATTGTGTCGATTGTGTCCAGTTGGAATCAACAAGGAATCAACAATACTTAAATGCTACAATGCTACTATGCTAACTTATTTAATATTTAAATTATGTGGCCGTGTTCCATTATGTGGCCGTGTTCCAGGGCGC

Full Affymetrix probeset data:

Annotations for 1641585_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720